... problems and finally addiction. It is certain that the physical and psychological problems that accompany the pathological relationship with alcohol increase with the quantity consumed and the frequency ... func- tional activity of the proteins that are already inside the neuron or through the influence of alcohol on their 'real' quantity in the neuron [30]. Psyc...
Ngày tải lên: 08/08/2014, 23:21
... were matured over two days, harvested and analyzed for cell yield and mature DC phenotype by flow cytometry, and then functionally analyzed for their ability to activate allogeneic T-cell or recall antigen ... and CD86 and analyzed by flow cytometry. In each case all the isolated floating cells were analyzed without gating and phenotype of DC compared between the roller bottles and sta...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " A global survey identifies novel upstream components of the Ath5 neurogenic network" pdf
... Santa Clara, California, USA) The median of the raw ratio between the firefly luciferase and the Renilla luciferase of each tripli- cate was normalized against the median of all ratios of the 96- well ... accepting a number of false-negatives. In general, the rate of false negatives obtained by TRS will depend critically on the quality and coverage of the ref...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf
... used AGGAAAAGGCCTTGAAGCTC and TGCTGTATTTGACAGGACAAGTG (outer primers), and GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAG- GACAAGTG (inner primers). For CN272097 we used CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCT- TCTCATTTAG ... structural aber- rations. Spectrum-based classification and analysis of the flu- orescent images (SKY) was achieved using SkyView™ software (Applied Spectral Imaging, C...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot
... C-terminal regions and analyzed them by gel filtration, citrate synthase assay and coaffinity purification. Truncation of more than the initial few amino acids of the N-terminal region led to the formation of distinct ... studies have mainly been focused on the mammalian representatives aA- and aB-crystallin. These proteins proved remarkably resistant against mutational alterations....
Ngày tải lên: 31/03/2014, 21:21
Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx
... morning and 300 mg at night. She was subsequently reviewed in the outpa- tient clinic regularly and has remained well. Another literature search (of the same original databases) yielded no further ... Rush AJ: Clinical outcome in a randomized 1-year trial of clozapine versus treatment as usual for patients with treatment-resistant ill- ness and a history of mania. Am J Psychiatry...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... 83:1174- 1178. 19. Kasama T, Shiozawa F, Kobayashi K, Yajima N, Hanyuda M, Takeuchi TT, Mori Y, Negishi M, Ide H, Adachi M: Vascular endothelial growth factor expression by activated synovial leukocytes in ... transillumination. Statistical analysis Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus Concept Inc, Berkeley, CA, USA)...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "A blind deconvolution approach to high-resolution mapping of transcription factor binding sites from ChIP-seq data" pps
... ChIP-seq, anal- ysis techniques that accurately translate sequencing reads into reliable calls of the genomic locations of the sites of protein-DNA interaction are necessary. To date, a number of such ... of achieving a greater level of accuracy, as determined by motif analysis, than do alter- native methods when calling the same number of binding sites. We demonstrate...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: "A scaling normalization method for differential expression analysis of RNA-seq data" pps
... demon- strate here t hat the reality of RNA-seq data analysis is not this simple; normalization is often still an important consideration. Current RNA-seq analysis methods typically standar- dize data ... sources of RNA), assuming the microarray data have been appropriately normalized (Figure S2 in Additional file 1). Taken together, these results indicate a critical role for the...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: " A rapid method to screen putative mRNA targets of any known microRNA" pdf
... F:5’-GGACTAGTAGGCCTTTCACAACTAGGACTGA R:5’-CCCAAGCTTAAACTGCAAATAGTCGTTACAAA Homo sapiens transportin 1 F:5’-GGACTAGTTCTAATACACTTAAGCTGCAGT R:5’-CCCAAGCTTGCTTCTTCACATCCACTGCGGAGT Homo sapiens ribosomal ... sapiens mRNA for putative NFkB activating protein F:5’-GGACTAGTTGAACACAGAAAGTCTAAGAGGA R:5’-CCCAAGCTTGCTAATTAAACTTTGATTTTATTATG HCMV UL17/18 F:5’-GGACTAGTTACCAGCGGTTACGCACCGAG R:5’-CCCAAGCTTA...
Ngày tải lên: 11/08/2014, 21:21