Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf
Báo cáo y học: "A short review on the aetiology and pathophysiology of alcoholism" ppt
... problems and finally addiction. It is certain that
the physical and psychological problems that accompany
the pathological relationship with alcohol increase with
the quantity consumed and the frequency ... func-
tional activity of the proteins that are already inside the
neuron or through the influence of alcohol on their 'real'
quantity in the neuron [30].
Psyc...
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... were
matured over two days, harvested and analyzed for cell yield and mature DC phenotype by flow
cytometry, and then functionally analyzed for their ability to activate allogeneic T-cell or recall
antigen ... and CD86 and analyzed by flow cytometry. In each case all the isolated floating cells
were analyzed without gating and phenotype of DC compared between the roller bottles and sta...
Báo cáo y học: " A global survey identifies novel upstream components of the Ath5 neurogenic network" pdf
... Santa
Clara, California, USA) The median of the raw ratio between
the firefly luciferase and the Renilla luciferase of each tripli-
cate was normalized against the median of all ratios of the 96-
well ... accepting a number of false-negatives. In general, the
rate of false negatives obtained by TRS will depend critically
on the quality and coverage of the ref...
Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf
... used
AGGAAAAGGCCTTGAAGCTC and
TGCTGTATTTGACAGGACAAGTG (outer primers), and
GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAG-
GACAAGTG (inner primers). For CN272097 we used
CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCT-
TCTCATTTAG ... structural aber-
rations. Spectrum-based classification and analysis of the flu-
orescent images (SKY) was achieved using SkyView™
software (Applied Spectral Imaging, C...
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot
... C-terminal
regions and analyzed them by gel filtration, citrate synthase
assay and coaffinity purification. Truncation of more than
the initial few amino acids of the N-terminal region led to the
formation of distinct ... studies have mainly
been focused on the mammalian representatives aA- and
aB-crystallin. These proteins proved remarkably resistant
against mutational alterations....
Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx
... morning and 300
mg at night. She was subsequently reviewed in the outpa-
tient clinic regularly and has remained well.
Another literature search (of the same original databases)
yielded no further ... Rush AJ: Clinical
outcome in a randomized 1-year trial of clozapine versus
treatment as usual for patients with treatment-resistant ill-
ness and a history of mania. Am J Psychiatry...
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... 83:1174-
1178.
19. Kasama T, Shiozawa F, Kobayashi K, Yajima N, Hanyuda M,
Takeuchi TT, Mori Y, Negishi M, Ide H, Adachi M: Vascular
endothelial growth factor expression by activated synovial
leukocytes in ... transillumination.
Statistical analysis
Data were analyzed on a Power Macintosh computer using
a statistical software package (Statview 4.5; Abacus
Concept Inc, Berkeley, CA, USA)...
Báo cáo y học: "A blind deconvolution approach to high-resolution mapping of transcription factor binding sites from ChIP-seq data" pps
... ChIP-seq, anal-
ysis techniques that accurately translate sequencing reads
into reliable calls of the genomic locations of the sites of
protein-DNA interaction are necessary. To date, a number
of such ... of achieving a greater level of
accuracy, as determined by motif analysis, than do alter-
native methods when calling the same number of binding
sites. We demonstrate...
Báo cáo y học: "A scaling normalization method for differential expression analysis of RNA-seq data" pps
... demon-
strate here t hat the reality of RNA-seq data analysis is
not this simple; normalization is often still an important
consideration.
Current RNA-seq analysis methods typically standar-
dize data ... sources of RNA),
assuming the microarray data have been appropriately
normalized (Figure S2 in Additional file 1). Taken
together, these results indicate a critical role for the...
Báo cáo y học: " A rapid method to screen putative mRNA targets of any known microRNA" pdf
... F:5’-GGACTAGTAGGCCTTTCACAACTAGGACTGA
R:5’-CCCAAGCTTAAACTGCAAATAGTCGTTACAAA
Homo sapiens transportin 1 F:5’-GGACTAGTTCTAATACACTTAAGCTGCAGT
R:5’-CCCAAGCTTGCTTCTTCACATCCACTGCGGAGT
Homo sapiens ribosomal ... sapiens mRNA for putative NFkB activating protein F:5’-GGACTAGTTGAACACAGAAAGTCTAAGAGGA
R:5’-CCCAAGCTTGCTAATTAAACTTTGATTTTATTATG
HCMV UL17/18 F:5’-GGACTAGTTACCAGCGGTTACGCACCGAG
R:5’-CCCAAGCTTA...