Báo cáo y học: " PHOSIDA (phosphorylation site database): management, structural and evolutionary investigation, and prediction of phosphosites" ppsx

Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"

Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"

... original work is properly cited. Research Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators Marin ... design, analysis of results, interpretation of findings, and drafting of the paper. Independent statistical analysis. The accuracy of the data anal...
Ngày tải lên : 25/10/2012, 10:02
  • 10
  • 557
  • 1
 Báo cáo y học: "1, 25-dihydroxyvitamin D3 decreases adriamycin-induced podocyte apoptosis and loss"

Báo cáo y học: "1, 25-dihydroxyvitamin D3 decreases adriamycin-induced podocyte apoptosis and loss"

... on podocytes may be attributable to inhibit podocyte apoptosis and the amelioration of podocytopenia. Key words: 1, 25 -dihydroxyvitamin D3, podoc yte, proteinuria Introduction Podocytes ... renin-angiotensin system. J Clin Invest. 2002; 110: 229-238 8. Kuhlmann A, Haas CS, Gross ML, et al. 1 ,25-Dihydroxyvitamin D3 decreases podocyte loss and podocyte hypertrophy in...
Ngày tải lên : 25/10/2012, 11:40
  • 10
  • 463
  • 0
Báo cáo y học: "Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less"

Báo cáo y học: "Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less"

... 7(5):309-313 â Ivyspring International Publisher. All rights reserved Research Paper Clinical Strategy for the Management of Solid Pseudopapillary Tumor of the Pancreas: Aggressive or Less? Hong ... analysis of sol- id -pseudopapillary tumor of the pancreas: report of 15 cases. Hepatobilliary Pancreat Dis Int. 2008;7(2):196-200. 10. Yu CC, Yeh CN,...
Ngày tải lên : 25/10/2012, 11:40
  • 5
  • 640
  • 0
Báo cáo Y học: An active site homology model of phenylalanine ammonia-lyase from Petroselinum crispum docx

Báo cáo Y học: An active site homology model of phenylalanine ammonia-lyase from Petroselinum crispum docx

... catalysis. Keywords: phenylalanine ammonia-lyase; PAL; MIO; site- directed mutagenesis; homology model. Phenylalanine ammonia-lyase (PAL; EC 4.3.1.5) is a very important plant enzyme that catalyses ... for Organic Chemistry, University of Karlsruhe, Germany; 2 Institute for Organic Chemistry, Budapest University of Technology and Economics, Hungary The plant enzyme phenylalan...
Ngày tải lên : 08/03/2014, 23:20
  • 11
  • 411
  • 0
Báo cáo Y học: Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? ppt

Báo cáo Y học: Does phosphorylation of the cap-binding protein eIF4E play a role in translation initiation? ppt

... formation [4,6,7]. Phosphorylation of 4E-BP1 is blocked by rapamy- cin, which inhibits the mTOR (mammalian target of rapamycin) signalling pathway (see accompanying review by Proud [1]). Rapamycin ... formation or the ability of agents that activate the Erk pathway to stimulate protein synthesis. The authors argue that the inhibitory effect of Mnk activity on cap-depende...
Ngày tải lên : 23/03/2014, 21:20
  • 10
  • 504
  • 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5Â-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3Â. C17 0A: 5Â-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3Â.C-213S:5Â-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3Â. C25 7A: 5ÂGCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3Â. ... H24 4A: 5Â-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3Â. D21 6A: 5Â-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3Â All of the primers were 5Â-phosphoryla...
Ngày tải lên : 24/03/2014, 04:21
  • 8
  • 345
  • 0
Báo cáo y học: "CTCF binding site classes exhibit distinct evolutionary, genomic, epigenomic and transcriptomic features" docx

Báo cáo y học: "CTCF binding site classes exhibit distinct evolutionary, genomic, epigenomic and transcriptomic features" docx

... R131 Research CTCF binding site classes exhibit distinct evolutionary, genomic, epigenomic and transcriptomic features Kobby Essien Ô * , Sebastien Vigneau Ô , Sofia Apreleva Ô * , Larry N Singh * , ... these classes of CTCF sites in terms of their genomic, epigenomic, transcriptomic, functional and evolutionary properties. Most notably, we discovered that low-occ...
Ngày tải lên : 09/08/2014, 20:21
  • 15
  • 219
  • 0
Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf

Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf

... and u se information stored in genome databases, is an essential part of genomic and bioinformatic analysis [1-4]. While now primarily a basic research tool, analysis of genome annotation information ... Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors. Journal of...
Ngày tải lên : 10/08/2014, 09:22
  • 10
  • 386
  • 0
Báo cáo y học: " Flexible catalytic site conformations implicated in modulation of HIV-1 protease autoprocessing reactions" pps

Báo cáo y học: " Flexible catalytic site conformations implicated in modulation of HIV-1 protease autoprocessing reactions" pps

... A, Y, H, or N completely abolishes enzymatic activity [1-4]. In the HIV-1 infected cell, the protease is initially synthesized as part of the Gag-Pol polyprotein precursor, within which the HIV-1 ... different C-terminal flanking sequences could influence the proteolytic activity of the embedded protease by modulating the catalytic site conformation, revealing an additio...
Ngày tải lên : 13/08/2014, 01:21
  • 38
  • 180
  • 0
Báo cáo y học: " A single site for N-linked glycosylation in the envelope glycoprotein of feline immunodeficiency virus modulates the virus-receptor interaction" ppt

Báo cáo y học: " A single site for N-linked glycosylation in the envelope glycoprotein of feline immunodeficiency virus modulates the virus-receptor interaction" ppt

... behaved essentially the same as the pseudotypes bearing the T271I mutant Envs in the entry assay (Fig. 3A and 3B), in the syncytial assay, the Δ2N mutant Envs showed a marked reduction in syncytia ... following in vivo replication of mutant virus [87]. These data suggest that the predicted N- link glycosylation sites at N269 and N342 are critical for maintaini...
Ngày tải lên : 13/08/2014, 05:21
  • 16
  • 428
  • 0
Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx

Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx

... spectra of the synthetic peptides P1, P5, and recombinant peptides P5L and P7, at a concentration of 10 μM and in a pH 7.2 buffer, displayed a positive peak after 195 nm and two negative maxima at ... purposes) Retrovirology Open Access Research Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and i...
Ngày tải lên : 13/08/2014, 05:21
  • 12
  • 304
  • 0
Báo cáo y học: "Variation in the PaO2/FiO2 ratio with FiO2: mathematical and experimental description, and clinical relevance" pptx

Báo cáo y học: "Variation in the PaO2/FiO2 ratio with FiO2: mathematical and experimental description, and clinical relevance" pptx

... S, Murley D, Toft E: Oxygenation within the first 120 h following coronary artery bypass grafting. Influence of systemic hypothermia (32 degrees C) or normothermia (36 degrees C) during the cardi- opulmonary ... oxy- gen in the lung capillary blood increases. As the lung capillary blood mixes with that shunted, the increase in the partial pres- sure of oxygen in the lung...
Ngày tải lên : 13/08/2014, 08:21
  • 8
  • 220
  • 0
Báo cáo y học: "Tyrosine phosphorylation of myosin heavy chain during skeletal muscle differentiation: an integrated bioinformatics approach" doc

Báo cáo y học: "Tyrosine phosphorylation of myosin heavy chain during skeletal muscle differentiation: an integrated bioinformatics approach" doc

... 00.0 313 Y - YP - Y Y YP Y Y C(4) 7 5 8 6.7 413 Y Y Y Y - Y Y - E(7) (68) 68.0 435 - Y - H(9) (0.7) 4 3 2.6 504YYYYYYY H(9)06 95.0 719 Y Y Y Y Y YP YP YP YP YP YP Y H(6) (21.8) 19 9 16.6 1379YYYYYYY ... MYSS_ CHICK MYH3_ CHICK MYH3 MYH1 1BR2 1B7T:A 2MYS: A Mean 47 - - - Y - - - E(4) (14.5) (21) (16) 18.5 54 Y E(7) (52)(60)56.0 85YYYYYYY C(2)(34.7)(28)1626.2 163YYYYY...
Ngày tải lên : 13/08/2014, 22:22
  • 6
  • 192
  • 0
Báo cáo y học: " PHOSIDA (phosphorylation site database): management, structural and evolutionary investigation, and prediction of phosphosites" ppsx

Báo cáo y học: " PHOSIDA (phosphorylation site database): management, structural and evolutionary investigation, and prediction of phosphosites" ppsx

... constrained to sites of high accessibility and structural flexibility. Particularly in the case of serine and threonine, phosphorylation is almost completely restricted to loops and hinges. Tyrosine ... constraints of phospho- rylation sites between the MitoCheck study and this study also implicitly validate our use of the SABLE prediction tool for secondary structure and...
Ngày tải lên : 14/08/2014, 08:20
  • 13
  • 190
  • 0
Báo cáo y học: " Parallel RNAi screens across different cell lines identify generic and cell type-specific regulators of actin organization and cell morphology" pptx

Báo cáo y học: " Parallel RNAi screens across different cell lines identify generic and cell type-specific regulators of actin organization and cell morphology" pptx

... R26 Research Parallel RNAi screens across different cell lines identify generic and cell type-specific regulators of actin organization and cell morphology Tao Liu * , David Sims † and Buzz Baum * Addresses: ... in which mnb/DYRK1A acts. Conclusions: Using parallel RNAi screens and gene expression analyses across cell types we have identifie...
Ngày tải lên : 14/08/2014, 21:20
  • 9
  • 251
  • 0

Xem thêm

Từ khóa: