Báo cáo y học: "Could a simple surgical intervention eliminate HIV infection?" pps

... daily. Depletion of lymphocytes as a therapy for AIDS, based on a population dynamic model, has been advocated by de Boer and Boucher [8]. They proposed that using a suitable immunosuppressant ... combination with an anti-viral therapy may eliminate the infection. This author has arrived at the same result independently using a population dynamics model (three populations, as descri...

Ngày tải lên: 13/08/2014, 22:22

... specific pathogenic pathways. Others, such as hypothermia for the treatment of brain injury after cardiac arrest, have multiple additive and synergistic mechanisms of action that culminate in the protection ... have intensified in the past few years. Early candidates for brain injury biomarkers included lactate dehydrogenase and creatinine kinase enzyme subtypes in the serum and cerebrospinal...

Ngày tải lên: 13/08/2014, 16:21

... factor, α1-antitrypsin) and nasal mucociliary clearance (meas- ured by the saccharin test and nasal nitric oxide measure- ment). No patient had a history of salt wasting or a familial history of respiratory ... subnormal respiratory function. None had a bronchial colonization by Pseudomonas aeruginosa. In patients from group 1, all but one had a normal or a very low basal nasal PD a...

Ngày tải lên: 12/08/2014, 15:21

... summary page displays each list from the database that significantly matched the data, along with links to list annotations and Listmatch pages. (c) An example Listmatch page, which displays all ... by hand. Each gene was assigned, after a laborious literature search, to an arbitrary functional category like 'DNA repair' or 'metabo- lism'. A hypothesis might be based...

Ngày tải lên: 14/08/2014, 14:22

... cytometry assays and CSF CCL2 ELISA assays, and analysed and interpreted flow cytometry data. RWP designed and oversaw the study, examined study participants, performed lumbar punctures, analysed and ... testing and managed the data. DF performed assays of CSF and plasma neopterin. ES designed the flow cytometry assays, directed the SFGH Clinical Immunology Laboratory that performed the flow...

Ngày tải lên: 10/08/2014, 05:22

... 2009, 339:147-175. Sloan and Wainberg Retrovirology 2011, 8:52 http://www.retrovirology.com/content/8/1/52 Page 13 of 15 106. Matsuura Y, Maekawa M, Hattori S, Ikegami N, Hayashi A, Yamazaki S, Morita C, Takebe Y: ... decay in the various infected cell types is that raltegravir acted at a later stage of viral replication than efavirenz, and was thus able to influence its antiviral effect...

Ngày tải lên: 13/08/2014, 01:21

... significant cytological atypia or invasion of the appen- diceal wall by atypical glands was noted (Figures 2 and 3). A final histopathological diagnosis of mucinous cystade- noma was made. The patient ... 2 Department of Pathology, Aga Khan University, Stadium Road, Karachi 74800, Pakistan and 3 Medical College, Aga Khan University, Stadium Road, Karachi 74800, Pakistan References 1. Za...

Ngày tải lên: 11/08/2014, 12:20

... cardiovascular disease. In addition, data on food in- take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. M...

Ngày tải lên: 03/11/2012, 11:52

... 15, 431–440. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pharmacol. 86, 203–214. 56. Miyazaki,M.,Wada,T.,Shiota,N.&Takai,S.(1999)Effectofan angiotensin ... Biomedical Research, Hino, Tokyo, Japan; 2 TEIJIN Material Analysis Research Laboratories, Tokyo, Japan; 3 Center f...

Ngày tải lên: 08/03/2014, 09:20

... forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPT...

Ngày tải lên: 18/03/2014, 01:20