Báo cáo y học: "Ave, CESAR, morituri te salutant! (Hail, CESAR, those who are about to die salute you!)" ppsx

Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

Báo cáo y học: "Genetic polymorphism of p53, but not GSTP1, is association with susceptibility to esophageal cancer risk – A Meta-Analysis"

... p53 may play more important role in esophageal cancer risk. In the present meta-analysis on the association between p53 Arg72Pro, GSTP1 Ile105Val polymor- phisms and risk of esophageal cancer, ... Prior to this, SCC comprised more than 95% of esophageal malignancies [48]. In our meta-analysis, we had wanted to analysis the associa- tion between these two gene polymo...

Ngày tải lên: 25/10/2012, 11:40

9 615 0
Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx

Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx

... 2002 Cytoplasmic trehalose oligosaccharides (Eur. J. Biochem. 269) 3147 Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides ... stachyose. Ó FEBS 2002 Cytoplasmic trehalose oligosaccharides (Eur. J. Biochem. 269) 3143 The origin of these cytosolic oligosaccharides is not know...

Ngày tải lên: 22/02/2014, 07:20

8 404 0
Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

... raises the possibility that any one or a combination of these properties may in uence the binding of apolipoproteins to lipoprotein particles. The capacity to fractionate lipid emulsions into relatively ... apolipoprotein E3 and E4 to emulsions (Eur. J. Biochem. 269) 5941 Differences in the binding capacity of human apolipoprotein E3 and...

Ngày tải lên: 08/03/2014, 09:20

11 600 0
Báo cáo Y học: Assignment of molecular properties of a superactive coagulation factor VIIa variant to individual amino acid changes potx

Báo cáo Y học: Assignment of molecular properties of a superactive coagulation factor VIIa variant to individual amino acid changes potx

... Assignment of molecular properties of a superactive coagulation factor VIIa variant to individual amino acid changes Egon Persson 1 and Ole H. Olsen 2 1 Haemostasis Biology and 2 Medicinal Chemistry Research ... pro- found effect on all these parameters. Keywords: factor VIIa variant; factor X activation; intrinsic activity; superactivity; zymogenicity....

Ngày tải lên: 08/03/2014, 09:20

6 301 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

... additional data showing that b-expansins resemble ancient and modern cathepsin B, which is a member of the papain (C1) family of cysteine proteinases. Using the Pichia pastoris expression system, ... Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine prot...

Ngày tải lên: 08/03/2014, 22:20

10 535 0
Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx

Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx

... oligonucleotides: 5Â-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3Â,5Â-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3Â,and5Â-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3Â, respectively. Production of recombinant ... displays de novo electrophysiological properties similar to those of a- like toxins Balkiss Bouhaouala-Zahar 1 , Rym Benkhalifa 1 , Najet Srairi 1 , Ilhem Zenouak...

Ngày tải lên: 08/03/2014, 23:20

11 523 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

... very close to that of the mouse Muc4 (Table 1). The size of intron 1 of the human MUC4 has been estimated to be  15 kb by restriction mapping [12] and to be at least 20 kb by our analysis of the ... in mucin, contained only by the mouse submandibular small mucin [26]. The consensus sequence of the Muc4 tandem repeat is very close to that of SMC....

Ngày tải lên: 08/03/2014, 23:20

10 435 0
Báo cáo Y học: Modelling of simple and complex calcium oscillations From single-cell responses to intercellular signalling pdf

Báo cáo Y học: Modelling of simple and complex calcium oscillations From single-cell responses to intercellular signalling pdf

... Princeton, NJ. Ó FEBS 2002 Modelling calcium oscillations (Eur. J. Biochem. 269) 1355 REVIEW ARTICLE Modelling of simple and complex calcium oscillations From single-cell responses to intercellular ... study of the phosphoinositide p athway, of which the hydrolysis of PIP 2 into IP 3 and DAG is but a tiny part. A number of phosphoinositides linked b y...

Ngày tải lên: 24/03/2014, 00:21

23 464 0
Báo cáo y học: "Phân vùng dịch tễ Sốt rét can thiệp tại các tỉnh miền bắc việt nam năm 2009" pptx

Báo cáo y học: "Phân vùng dịch tễ Sốt rét can thiệp tại các tỉnh miền bắc việt nam năm 2009" pptx

... Phân vùng dịch tễ Sốt rét can thiệp tại các tỉnh miền bắc việt nam năm 2009 Nguyễn Mạnh Hùng* Tóm tắt Phân vùng dịch tễ sốt rét (SR) can thiệp năm 2009 đợc triển khai tại 28 tỉnh, thành ... phân vùng dịch tễ SR can thiệp tại các tỉnh khu vực phía Bắc đợc triển khai với các mục tiêu: (1) Phân vùng dịch tễ SR că...

Ngày tải lên: 07/08/2014, 00:23

5 587 0
Báo cáo y học: "ĐẶC ĐIỂM DỊCH TỄ HỌC BỆNH CÚM A/H5N1 TRÊN NGƯỜI Ở VIỆT NAM (2003 - 2010)" pdf

Báo cáo y học: "ĐẶC ĐIỂM DỊCH TỄ HỌC BỆNH CÚM A/H5N1 TRÊN NGƯỜI Ở VIỆT NAM (2003 - 2010)" pdf

... bệnh truyền nhiễm ở Việt Nam. Hà Nội. 9 - 2009, tr. 2-8 . ặC IểM DCH Tễ HC BệNH CM A/H 5 N 1 TRêN NGI ở VIỆT NAM (2003 - 2010) Phạm Ngọc Đính*; Nguyễn Trần Hiển*; Nguyễn Thu Y n*; Phạm Ngọc ... cũng cho th y xu hướng giảm dần tỷ lệ mắc bệnh cúm A/H 5 N 1 trên người, báo hiệu khả năng dịch chuyển sang dạng lưu hành (trên đàn gia cầm và g y...

Ngày tải lên: 07/08/2014, 02:24

7 654 1
Báo cáo y học: "ĐẶC ĐIỂM GIẢI PHẪU MẠCH XIÊN CỦA VẠT DA CƠ LƯNG TO Ở NGƯỜI TRƯỞNG THÀNH VIỆT NAM " docx

Báo cáo y học: "ĐẶC ĐIỂM GIẢI PHẪU MẠCH XIÊN CỦA VẠT DA CƠ LƯNG TO Ở NGƯỜI TRƯỞNG THÀNH VIỆT NAM " docx

... giải phẫu mạch xiên của cơ lưng to. Chúng tôi nghiên cứu đề tài n y với mục đích: tìm hiểu đặc điểm giải phẫu mạch xiên của vạt da cơ lưng to ở người trưởng thành Việt Nam. đối t-ợng ... ngoài cơ lưng to và xác định số lượng mạch xiên cơ - da của từng vạt. Tổng số mạch xiên cơ - da là 234 mạch/ 22 vạt nghiên cứ...

Ngày tải lên: 07/08/2014, 03:20

13 647 1
Báo cáo y học: "NGHIêN CứU DịCH Tễ LÂM SÀNG RốI LoạN TRầM CảM TạI MộT XÃ đồNG BằNG SôNG HồNG" ppsx

Báo cáo y học: "NGHIêN CứU DịCH Tễ LÂM SÀNG RốI LoạN TRầM CảM TạI MộT XÃ đồNG BằNG SôNG HồNG" ppsx

... CứU DịCH Tễ LÂM SÀNG RốI LoạN TRầM CảM TạI MộT XÃ đồNG BằNG SôNG HồNG Nguyễn Vn Siờm* Tóm tắt Nghiờn cu ti mt xó ng bằng sông Hồng (dân số 4.156 người) cho th y tỷ lệ mắc rối loạn trầm ... nghiên cứu: Phát hiện các BN trầm cảm đáp ứng tiêu chuẩn chẩn đoán của ICD-10 tại một xã. Phân tích các nét lâm sàng về rối loạn trầm cảm....

Ngày tải lên: 07/08/2014, 03:22

21 704 0
Báo cáo y học: "Inhaled nitric oxide in persistent pulmonary hypertension of the newborn refractory to high-frequency ventilatio" ppsx

Báo cáo y học: "Inhaled nitric oxide in persistent pulmonary hypertension of the newborn refractory to high-frequency ventilatio" ppsx

... arterial/alveolar oxygen ratio; INO, inhalational nitric oxide. All values shown as mean ± SEM; *P < 0.05. Inhaled nitric oxide in persistent pulmonary hypertension of the newborn refractory to high-frequency ... persistent pulmonary hyper- tension of the newborn. Pediatrics 1996, 98:706–713. 12. The Neonatal Inhaled Nitric Oxide Study (NINOS) Gro...

Ngày tải lên: 12/08/2014, 18:20

4 175 0
Báo cáo y học: " Impact factor, H index, peer comparisons, and Retrovirology: is it time to individualize citation metrics?" ppsx

Báo cáo y học: " Impact factor, H index, peer comparisons, and Retrovirology: is it time to individualize citation metrics?" ppsx

... exist. This was a period when if one wished to learn what was being pub- lished, one had to reach for the weekly/monthly periodi- cals (that often meandered through the postal service sometimes, ... spotlights what IF in part does and does not convey. With that disclaimer, how is Retrovirology doing IF-wise as the journal enters its fourth year? Employing the algorithm that IF derives...

Ngày tải lên: 13/08/2014, 05:22

4 236 0
Báo cáo y học: "Ave, CESAR, morituri te salutant! (Hail, CESAR, those who are about to die salute you!)" ppsx

Báo cáo y học: "Ave, CESAR, morituri te salutant! (Hail, CESAR, those who are about to die salute you!)" ppsx

... with similar services to those in the UK. (ISRCTN47279827) â 2010 BioMed Central Ltd Ave, CESAR, morituri te salutant! (Hail, CESAR, those who are about to die salute you!) David J Wallace 1 , ... morituri te salutant! (Hail, CESAR, those who are about to die salute you!). Critical Care 2010, 14:308. Wallace et al. Critical Care 2010,...

Ngày tải lên: 13/08/2014, 20:21

3 200 0
Từ khóa:
w