Báo cáo y học: "Filtering out the noise: evaluating the impact of noise and sound reduction strategies on sleep quality for ICU patients" ppt

... Microar- ray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts. Cerebro- spinal Fluid Research. 2010; 7: 6-13. 20. Helland CA, Aarhus M, Knappskog ... trauma, infection, intrauterine catastrophes 16 or head surgery 17 . In our case, the lack of a previous history of trauma, infection and head surgery leads us to...

Ngày tải lên: 25/10/2012, 11:00

... PHC data of the statements made by the mid-wife in her records of the check-up of the mothers during the pregnancy (17). In the follow-up at the age of seven, n= 191 children of the defined ... perspective of child- hood asthma could thus be to focus on factors aiding children with asthma to getting better over the years. The aim of this stu...

Ngày tải lên: 26/10/2012, 09:48

... dislocations regarding the femoral part. In the literature, the dislocation rates after hip spacer implantation may strongly vary depending on the art of the spacer s production as well as the fixa- tion ... evidence of the same organism of both the urinary tract and the hip pros- thesis [13]. Pulido et al. tried recently to identify pre- disposing factor...

Ngày tải lên: 26/10/2012, 09:53

... 3(4):117-123 â2006 Ivyspring International Publisher. All rights reserved Review PARP-1 inhibitors: are they the long-sought genetically specific drugs for BRCA1/2-associated breast cancers? Joseph ... non-responsive to the treatment. It was therefore proposed that PARP-1 inhibitors might be the long-sought genetically specific drugs that are both safe...

Ngày tải lên: 31/10/2012, 16:57

... (theory of molecular mimicry) [20]. Alternatively, Review Targeting Toll-like < /b> receptor < /b> signaling < /b> in < /b> plasmacytoid < /b> dendritic < /b> cells < /b> and < /b> autoreactive < /b> B cells < /b> as a therapy for lupus Petar S Lenert Assistant ... structures, and < /b> are preferentially recognized by autoreactive < /b> B cells < /b> and < /b> plas...

Ngày tải lên: 09/08/2014, 07:20

... non-transduced and trans- duced cells. Primers specific for CXCR4 (forward: 5'-ggag- gggatcagtatatacacttc and reverse: 5'-cgccaacatagaccaccttttc) and CCR5 (forward: 5'-caaaaagaaggtcttcattacacc ... conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector Joseph Anderson and Ramesh Akkina* Address: Dept...

Ngày tải lên: 10/08/2014, 05:20

... and time are invested in the production of research knowledge. The primary objective of this randomized controlled trial was to evaluate the effectiveness of three knowledge translation and exchange ... outcomes [1]. The purpose of this randomized controlled trial was to evaluate the impact of three knowl- edge translation and exchange (KTE)...

Ngày tải lên: 11/08/2014, 05:21

... Open Access Supportive treatment using a compression garment vest of painful sternal instability following deep surgical wound infection: a case report Andreas Klement 1* , Manfred Herrmann 2 Abstract Introduction: ... presentation: We report a case of painful sternal instability following open heart surgery in a 74-year-old Caucasian man. T...

Ngày tải lên: 11/08/2014, 07:20

... Research Open Access Research Health status measurement in COPD: the minimal clinically important difference of the clinical COPD questionnaire JWH Kocks 1 , MG Tuinenga 1 , SM Uil 2 , JWK van ... what is the minimal clinically important difference (MCID). This study aimed to identify the MCID for the clinical COPD questionnaire (CCQ) in terms...

Ngày tải lên: 12/08/2014, 16:20

... assess and quantify noises and occurrences that arouse the patient from sleep. Commentary Filtering out the noise: evaluating the impact of noise and sound reduction strategies on sleep quality for ... reduction strategies on sleep quality for critically ill patients. Evaluating the impact of noise on sleep quality is challe...

Ngày tải lên: 13/08/2014, 16:20

... question, there are substantial barriers to conducting such studies. â 2010 BioMed Central Ltd Figuring out what works: a need for more and better studies on the relationship between ICU organization ... assessed the association of outcomes with intensivists’ base speciality. However, very little is known about the relationships between ICU organi...

Ngày tải lên: 13/08/2014, 20:21

... 93: 1069-1076. doi:10.1186/cc9082 Cite this article as: Wilson J, Davies S: Improving surgical outcomes: it is the destination not the journey. Critical Care 2010, 14:177. Wilson and Davies Critical Care 2010, ... JWM, Ramsay G: Meta-analysis of hemodynamic optimization: relationship to methodological quality. Crit Care 2005, 9:771-779. 3. Abbas SM, Hill AG: Systematic rev...

Ngày tải lên: 13/08/2014, 20:22

... activities from combined analysis of microarray and ChIP data: a partial least squares approach Anne-Laure Boulesteix and Korbinian Strimmer* Address: Department of Statistics, University of Munich, ... connectivity information ( ). Our analysis of biological data shows the versatility of our PLS approach and at the same time dramatically confirms the n...

Ngày tải lên: 13/08/2014, 23:20

... thrombogenicity. Crit Care 2011, 15:201. â 2010 BioMed Central Ltd Correction: Clinical review: Prothrombin complex concentrates - evaluation of safety and thrombogenicity Benny Sørensen 1 *, ... Aachen, Germany. Published: 18 March 2011 Reference 1. Sørensen B, Spahn DR, Innerhofer P, Spannagl M, Rossaint R: Clinical review: Prothrombin complex concentrates...

Ngày tải lên: 14/08/2014, 07:21

... by 2033. It is, therefore, increasingly important to find ways of facilitating the maintenance of physical function, health and independence and quality of life of older individuals. This in ... frequency, purpose, and travel mode of daily trips in adults over 70 years (y) , and their association with participant characteristics and objectively as...

Ngày tải lên: 14/08/2014, 08:21