Báo cáo y học: "A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention" pdf

... Hoskins and Pollard: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention. Chiropractic & Osteopathy 2010 ... descriptive analysis of the usage of a sports chiropractic manual therapy intervention within a recent randomised controlled trial o...

Ngày tải lên: 13/08/2014, 14:20

... Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention Wayne Hoskins * and Henry Pollard ... this study. Because the study was conducted without institutional ethics committee approval it has been retracted. References 1. Hoskins W, Pollard H. A...

Ngày tải lên: 13/08/2014, 15:21

... coronary artery bypass grafts (within the last 7 days), and solid organ transplants (within the last 14 days). Patients were followed for 28 days after discharge from the ICU. The study was approved ... success of therapy. Current data support the hypothesis that a drop in PCT levels represents an adequate antimicrobial therapy and may actuallydefineatimepointwhereantibiotict...

Ngày tải lên: 14/08/2014, 07:21

... penetratin and the two analogues interact with negatively charged phospholipids, and that this is accompanied by a conformational change from random to a helical structure, and a deeper insertion of ... Vanderheyden 2 , Yves Engelborghs 2 , Alain Joliot 3 , Alain Prochiantz 3 , Joe¨ l Vandekerckhove 4 , Maryvonne Rosseneu 1 and Berlinda Vanloo 1 1 Laboratory for Lipoprotein...

Ngày tải lên: 31/03/2014, 23:20

... (21159) Homsa;CYCG1 Homsa;CYCG2 Arath;CYCD4;1 Arath;CYCD2;1 Homsa;CYCJ Homsa;CYCE2 Arath;CYCB1;1 Arath;CYCB3;1 Thaps (36441) Phatr;CYCP6 Phatr;CYCP4 Phatr;CYCP1 Phatr;CYCP5 Phatr;CYCP3 Phatr;CYCP2 Phatr;CYCH1 Phatr;CYCL1 Phatr;CYCD1 Phatr;CYCA/B;1 Arath;SDS Phatr;CYC-like Thap ... (264631) Thaps (20925) Arath;CYCH1 Ostta;CYCH Thaps (3949) Homsa;CYCL1 Arath;CYCL1;1 Thaps (17396) Thaps (17337)...

Ngày tải lên: 09/08/2014, 20:21

... (CCR5-F1: 5'ATGGAGGGCAACTAAATACATT3'; CCR5-R1: 5'AGATGACTATCTTTAATGTCTG3'; CCR5-F2: 5'CTCTCATTTTCCATACAGTCAGTATCA3'; CCR5-R2: 5'AAGCCATGTGCACAACTCTGACTG3') and ... CD45-F: 5'-GATTGACTACAG- CAAAGATGCCC-3' and CD45-R: 5'-CCTCTGTGGTAT- TAAAAGCACTAGCA-3'; subsequent HpaII digestion of PCR products evidenced the mutated allele after...

Ngày tải lên: 10/08/2014, 05:20

... report Daisuke Yoshioka, Toshiki Takahashi * , Toru Ishizaka and Takuya Higuchi Abstract Cardiac myxoma is the most common primary cardiac tumour, but infected cardiac myxoma is relatively rare. Infected ... toshiki@onh.go.jp Department of Cardiovascular surgery, Osaka National Hospital, 2-14 Hoenzaka, Chuo-ku, Osaka city, Osaka, 540-0006, Japan Yoshioka et al. Journal of Cardiothoracic...

Ngày tải lên: 10/08/2014, 09:21

... suspected of being a cervical lymph node metastatic carcinoma; therefore, it was inves- tigated for primary carcinoma, which was not identified. Clinically and radiographically, the mediastinum was clear. ... prostate-specific antigen-negative, human melanoma black marker 45-negative, melanoma marker-negative, cytokeratin-7-negative and multiple myeloma marker 1-positive in about 30...

Ngày tải lên: 11/08/2014, 00:23

... presentation of mucopolysaccharidosis type II (Hunter syndrome): a case report Gauri Shankar Shah*, Tania Mahal and Subodh Sharma Abstract Introduction: We present a very rare case of mucopolysaccharidosis ... normal intelligence; and radiological features such as a J-shaped sella turcica, beaking of vertebrae, proximal tapering of metacarpal bones and tapering of the p...

Ngày tải lên: 11/08/2014, 12:20

... coronary artery diseases. Case presentation A 64-year-old Asian man who was previously healthy and had no comorbidity presented for his annual physi- cal examination. He was not taking any medications except ... 2009 Accepted: 8 January 2010 Published: 8 January 2010 References 1. American Heart Association: Heart and Stroke Statistical Update Dallas: American Heart Association 1997....

Ngày tải lên: 11/08/2014, 14:21