Báo cáo y học: "Within a smoking-cessation program, what impact does genetic information on lung cancer need to have to demonstrate" ppsx

Báo cáo y học: "Within a smoking-cessation program, what impact does genetic information on lung cancer need to have to demonstrate" ppsx

Báo cáo y học: "Within a smoking-cessation program, what impact does genetic information on lung cancer need to have to demonstrate" ppsx

... study was to explore how much of an impact genetic testing information would need to have in order to be a cost-effective addition to a typical smoking-cessation program. Specifically, we assess ... smoking-cessation programs and pharmaceutical aids demonstrate substantial health gains for a relatively low allocation of resources. Genetic information represents...

Ngày tải lên: 13/08/2014, 11:22

10 289 0
Báo cáo y học: " Exhaled volatile organic compounds in patients with non-small cell lung cancer: cross sectional and nested short-term follow-up study" pptx

Báo cáo y học: " Exhaled volatile organic compounds in patients with non-small cell lung cancer: cross sectional and nested short-term follow-up study" pptx

... dis- cards anatomic dead space air; ii) its fixed resistance allows a reasonably constant expiratory flow; iii) it has no carry-over effects and permits the addition of internal standards to the ... alkanes and methylated alkanes have proved to be highly discriminating in distinguishing lung cancer patients from healthy controls, but breath analyses can be affected by both clinica...

Ngày tải lên: 12/08/2014, 18:21

10 426 0
Báo cáo y học: "Effectiveness of an evidence-based chiropractic continuing education workshop on participant knowledge of evidence-based health care" ppsx

Báo cáo y học: "Effectiveness of an evidence-based chiropractic continuing education workshop on participant knowledge of evidence-based health care" ppsx

... for enhanced patient management. Data collection and statistical analysis We calculated descriptive statistics: percentages, mean, standard deviation and range, as appropriate. For compar- ative analysis, ... way to engage adult learners." #10. "Too much information, very long. Good information. Give information before hand. No reason for people to read any notes out loud.&q...

Ngày tải lên: 13/08/2014, 14:20

8 185 0
Báo cáo y học: "Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention." pot

Báo cáo y học: "Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention." pot

... Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention Wayne Hoskins * and Henry Pollard ... Department of Chiropractic, Faculty of Science, Macquarie University, NSW 2109, Australia * Corresponding author: Wayne Hoskins waynehoskins@iinet.net.au Email: Wayne Hoskins waynehoski...

Ngày tải lên: 13/08/2014, 15:21

2 203 0
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"

Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"

... the above risk factor variables. In conclusion: a) hypoalbuminaemia is an independent predictor of CVD in early CKD stages; b) hypoalbu- minaemia may be used to identify the population at higher ... studies. Owen et al (33) demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis...

Ngày tải lên: 03/11/2012, 11:52

5 724 0
Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

... Biomedical Research, Hino, Tokyo, Japan; 2 TEIJIN Material Analysis Research Laboratories, Tokyo, Japan; 3 Center for Tsukuba Advanced Research Alliance, University of Tsukuba, Tsukuba, Ibaraki, Japan Although ... 15, 431–440. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pha...

Ngày tải lên: 08/03/2014, 09:20

10 382 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... following oligonucleotides: forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I ... D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AMY2 , Y2 11 AMY2 , ... TAA (in black). The superimpositioning was guided by the catalytic acids (D179 AMY2 , E204 AMY2 , and D289 AMY2 and D206 TAA , E230 TAA , and D297 TAA ). The invariant Y5 1 AMY2 and...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

... Fukuda, Takashi Sugimura, Minako Nagao and Hitoshi Nakagama Biochemistry Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan Recently, we have identified and purified minisatellite ... and 3-methylcholanthrene, detected by a DNA fingerprint assay. Cancer Res. 52, 5788–5793. 12. Kitazawa, T., Kominami, R., Tanaka, R., Wakabayashi, K. & Nagao, M. (1994) 2-Hydroxy...

Ngày tải lên: 31/03/2014, 23:20

7 305 0
Báo cáo y học: "Fluoxetine: a review on evidence based medicine" pdf

Báo cáo y học: "Fluoxetine: a review on evidence based medicine" pdf

... Lilly Italia S.p .A. via Gramsci, 731, Sesto fiorentino (Florence), Italy Email: Andrea Rossi* - rossi_andrea _a@ lilly.com; Alessandra Barraco - barraco_alessandra@lilly.com; Pietro Donda - donda_pietro@lilly.com * ... significantly greater remission and response rates, mean changes on HAMD-17 total score, anxiety/somatization, retardation and cognitive disturbance factor score, than place...

Ngày tải lên: 08/08/2014, 20:23

8 608 0
Từ khóa:
w