Báo cáo khoa học: "wards goal-directed therapy of hepatorenal syndrome: we have the tools but we need the trials" doc

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... here. Purification of four pulchellin isoforms from A. pulchellus seeds Using a combination of affinity, ion exchange and chromatofocusing chromatography, four pulchellin isoforms were isolated from A. pulchellus ... four pulchellin isoforms P. V. Castilho et al. 954 FEBS Journal 27 5 (20 08) 948959 ê 20 08 The Authors Journal compilation ê 20 08 FEBS Isol...

Ngày tải lên: 18/02/2014, 16:20

12 763 0
Tài liệu Báo cáo khoa học: "Portable Translator Capable of Recognizing Characters on Signboard and Menu Captured by Built-in Camera" docx

Tài liệu Báo cáo khoa học: "Portable Translator Capable of Recognizing Characters on Signboard and Menu Captured by Built-in Camera" docx

... Demonstration Sessions, pages 61–64, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics Portable Translator Capable of Recognizing Characters on Signboard and Menu Captured by Built-in ... small images of signboards can be quickly sent to the recognition and translation server. Since the server runs state of the art recogni- tion and transl...

Ngày tải lên: 20/02/2014, 15:20

4 494 0
Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx

Báo cáo khoa học: Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) pptx

... 2008 The Authors Journal compilation ê 2008 FEBS Spatio-temporal distribution of fatty acid-binding protein 6 (fabp6) gene transcripts in the developing and adult zebrafish (Danio rerio) Fernanda ... 2008) doi:10.1111/j.1742- 465 8.2008. 064 80.x We have determined the structure of the fatty acid-binding protein 6 (fabp6) gene and...

Ngày tải lên: 07/03/2014, 06:20

10 379 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

... CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA sense CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ACCACAGTCCATGCCATCAC GAPDH-R TCCACCACCCTGTTGCTGTA L. Vardouli ... (5Â-to3Â) hRhoB -825 GGGATCAGAGTTCATAGTGAAAAGAG hRhoB +86 GCG AAGCTTCGGCCTAGCTCTCTCCCGGGTCTC hRhoA )799 GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTAACGA hRhoB sen...

Ngày tải lên: 16/03/2014, 06:20

14 420 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC 6F-XHO AATTCTCGAGTGCTGCTGCTGCGAATGCTGC C3K -A7 K GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K ... (5Â3Â) MA(9) ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MGA(8) ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6...

Ngày tải lên: 16/03/2014, 16:20

12 512 0
Báo cáo khoa học: X-ray structure of glucose/galactose receptor from Salmonella typhimurium in complex with the physiological ligand, (2R)-glyceryl-b-D-galactopyranoside pdf

Báo cáo khoa học: X-ray structure of glucose/galactose receptor from Salmonella typhimurium in complex with the physiological ligand, (2R)-glyceryl-b-D-galactopyranoside pdf

... protein. This kind of protein is exemplified by the Thermus thermophilus protein, PDB entry 2B3B [28]. The mode of binding the monosaccharide is completely different in terms of orientation of the ... calcium site of domain 2 was described earlier, and tight binding of the ion was shown to con- tribute to the integrity of the protein structure [17,22]. The sod...

Ngày tải lên: 23/03/2014, 04:21

9 361 0
Báo cáo khoa học nông nghiệp " Improvement of operator skills and technology in small rural sawmills in Vietnam " MS7 doc

Báo cáo khoa học nông nghiệp " Improvement of operator skills and technology in small rural sawmills in Vietnam " MS7 doc

... 027/06VIE Improvement of operator skills and technology in small rural sawmills in Vietnam.  PolicyDocument:Thedevelopment of rural forestindustries in Vietnam Page40 of 46 9 Education and training in forestry,woodscience and timber engineering and furniture Most ... 027/06VIE Improvement of operator skills and technology in small rural sawmills in Vietnam.  PolicyDocument...

Ngày tải lên: 21/06/2014, 04:20

71 297 0
báo cáo khoa học: "A case report of male breast cancer in a very young patient: What is changing" docx

báo cáo khoa học: "A case report of male breast cancer in a very young patient: What is changing" docx

... Open Access A case report of male breast cancer in a very young patient: What is changing? Marcelo Madeira 1,2* , André Mattar 1,3 , Rodrigo José Barata Passos 1 , Caroline Dornelles Mora 3 , Luiz ... The pathophysiology of breast cancer in males is not adequately understood. As more cases of breast cancer in young male patients are inves- tig...

Ngày tải lên: 09/08/2014, 01:24

5 400 0
báo cáo khoa học: "Adenovirus-mediated delivery of bFGF small interfering RNA reduces STAT3 phosphorylation and induces the depolarization of mitochondria and apoptosis in glioma cells U251" pdf

báo cáo khoa học: "Adenovirus-mediated delivery of bFGF small interfering RNA reduces STAT3 phosphorylation and induces the depolarization of mitochondria and apoptosis in glioma cells U251" pdf

... delivery of bFGF small interfering RNA reduces STAT3 phosphorylation and induces the depolarization of mitochondria and apoptosis in glioma cells U251. Journal of Experimental & Clinical Cancer ... 7 of 7 RESEARC H Open Access Adenovirus-mediated delivery of bFGF small interfering RNA reduces STAT3 phosphorylation and induc...

Ngày tải lên: 10/08/2014, 10:21

7 268 0
báo cáo khoa học: "Discordant lymphoma consisting of splenic mantle cell lymphoma and marginal zone lymphoma involving the bone marrow and peripheral blood: a case report" potx

báo cáo khoa học: "Discordant lymphoma consisting of splenic mantle cell lymphoma and marginal zone lymphoma involving the bone marrow and peripheral blood: a case report" potx

... occurrence of splenic mantle cell lymphoma and marginal zone lymphoma involving the bone marrow and peripheral blood. Case presentation: We report the case of a 60-year-old asymptomatic Caucasian woman ... this article as: Carulli et al.: Discordant lymphoma consisting of splenic mantle cell lymphoma and marginal zone lymphoma inv...

Ngày tải lên: 10/08/2014, 23:20

7 363 0
báo cáo khoa học: " High risk behaviors of injection drug users registered with harm reduction programme in Karachi, Pakistan" docx

báo cáo khoa học: " High risk behaviors of injection drug users registered with harm reduction programme in Karachi, Pakistan" docx

... Central Page 1 of 6 (page number not for citation purposes) Harm Reduction Journal Open Access Research High risk behaviors of injection drug users registered with harm reduction programme in Karachi, ... (parents, siblings) Yes 30 (18.6) No 131 (81.3) Average age of initiation of drugs Age of initiation of drugs 15.9 years Average time initiation of...

Ngày tải lên: 11/08/2014, 18:20

6 231 0
Báo cáo khoa học: "In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene expression" pdf

Báo cáo khoa học: "In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene expression" pdf

... 1 of 9 (page number not for citation purposes) Virology Journal Open Access Research In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene ... by recruiting them to the HIV-1 promoter thus enhancing viral expression. On the other hand, the high frequency of the R77Q sub- stitution found in th...

Ngày tải lên: 12/08/2014, 04:21

9 199 0
Báo cáo khoa học: " In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene expression" docx

Báo cáo khoa học: " In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene expression" docx

... 1 of 9 (page number not for citation purposes) Virology Journal Open Access Research In vitro dynamics of HIV-1 BF intersubtype recombinants genomic regions involved in the regulation of gene ... proteins known to interact with viral promoter (LTR) during the replication cycle. This interaction is mainly involved in the regulation of viral gene...

Ngày tải lên: 12/08/2014, 04:22

9 230 0
Báo cáo khoa học: "Epidemiology and eradication of infectious bovine rhinotracheitis/infectious pustular vulvovaginitis (IBR/IPV) virus in Finland" docx

Báo cáo khoa học: "Epidemiology and eradication of infectious bovine rhinotracheitis/infectious pustular vulvovaginitis (IBR/IPV) virus in Finland" docx

... of infectious bovine rhinotracheitis eradication programmes in a fattening cattle farm. Prev Vet Med 1990, 9:121-130. 23. Bradley JA: Eradication of infectious bovine rhinotracheitis virus (bovine ... Central Page 1 of 6 (page number not for citation purposes) Acta Veterinaria Scandinavica Open Access Research Epidemiology and eradication of infectious bovine...

Ngày tải lên: 12/08/2014, 18:21

6 158 0
Từ khóa:
w