Báo cáo y học: " A novel function for spumaretrovirus integr

Báo cáo y học: " A novel function for spumaretrovirus integrase: an early requirement for integrase-mediated cleavage of 2 LTR circles" docx

... end 6 5 substrate CAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAA CAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAA CAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAA CAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGA GAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCC CAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG * * * * * * * * * * * * * * * * - ... (5'-GAA ACT AGG GAA AAC TAG G-3'), lambdaT (5'-ATG CCA CGT AAG CGA AAC T-3') a...

Ngày tải lên: 13/08/2014, 09:21

18 321 0

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

... enzyme and puriﬁed 4-amino- 3-hydroxybenzoate 2, 3-dioxygenase in a coupled assay was identiﬁed as 2- hydroxymuconic 6-semialdehyde by GC-MS analysis. A mechanism for the formation of 2- hydroxymuconic ... 174, 26 5 27 2. 7. Muraki, T., Taki, M., Hasegawa, Y. , Iwaki, H. & Lau, P.C. (20 03) Prokaryotic homologs of the euk aryotic 3-hydroxyanthranilate 3,4-diox ygena se an...

Ngày tải lên: 19/02/2014, 16:20

7 613 1

Báo cáo y học: " A formylpeptide receptor, FPRL1, acts as an efficient coreceptor for primary isolates of human immunodeficiency virus" docx

... Ishikawa K, Tsujimoto H, Nakai M, Mingle AJ, Osei-Kwasi M, Aggrey SE, Nettey VB, Afoakwa SN, Fukasawa M, Kodama T: Isolation and characterization of HIV -2 from an AIDS patient in Ghana. AIDS ... 5'-ATGGAGGGGATCAGTATATA- CACTTCAGAT-3' (sense: 1st–30th); and CXCR4CR, 5'- 'TTAGCTGGAGTGAAAACTTGAAGACTCAGA-3' (anti- sense, 979–1,008th) [NM003467 ]. FPRL1: FPRL1CN, 5&a...

Ngày tải lên: 13/08/2014, 05:21

14 304 0

Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx

... are underlined): for E318 to W, 5¢-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3¢; for E318 to I, 5¢-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3¢; for E318 to R, 5¢-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3¢; ... : a case con trol study. Lancet 353, 351–353. 20 . Matsubara, Y. , Mur ata, M., Maruyama, T., Handa, M., Yamagata, N ., Watanabe, G ., Saruta, T. & Ikeda, Y. (20 00) Association b...

Ngày tải lên: 08/03/2014, 22:20

9 471 0

Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

... and D) polymorphonuclear neutrophils. Panels A and C, stained by control IgG; panels B and D, stained by anti-IP-10 antibody. Panels B and D demonstrate a significant presence of cell-associated ... ultraviolet transillumination. Statistical analysis Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus Concept Inc, Berkeley, CA,...

Ngày tải lên: 09/08/2014, 01:21

8 446 0

Báo cáo y học: "A novel informatics concept for high-throughput shotgun lipidomics based on the molecular fragmentation query language" ppt

... Yes Yes Database of lipid masses Yes Yes Yes Yes Yes Yes Database of spectra Yes Database expandability Yes Yes Yes Yes Yes Isotopic correction Yes Yes Yes Yes Cross-platform Yes Yes Yes Yes Yes ... Shevchenko A: Global analysis of the yeast lipidome by quantitative shotgun mass spectrometry. Proc Natl Acad Sci USA 20 09, 106 :21 36 -21 41. 9. Han X, Yang K, Yang J, Fikes KN, Cheng H,...

Ngày tải lên: 09/08/2014, 22:23

25 514 0

Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

... Position As 5'-GAGTAGTGTTGGGTCGCGAA-3' 25 6 27 5 Aa 5'-GTGCACGGTCTACGAGACCTC-3' 320 340 Ap FAM5'-CCTGATAGGGTGCTTGCGAGTGCC-3' BHQ 29 2 315 Bs 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' ... of HBV DNA & HCV RNA among renal transplant recipients in India. Indian J Med Res 20 00, 111 :20 4 -21 1. 11. Daniel HD, Grant PR, Garson JA, Tedder RS, Chandy GM, Abr...

Ngày tải lên: 12/08/2014, 04:20

9 322 0

Báo cáo y học: "A novel method for purifying bluetongue virus with high purity by co-immunoprecipitation with agarose protein A" ppsx

... Lab. of Molecular Virus & Cancer, State Key Laboratory of Virology, Wuhan University School of Basic Medicine, Wuhan University, Wuhan 430071, China Full list of author information is available ... polyclonal antibody. Zhen et al. Virology Journal 20 10, 7: 126 http://www.virologyj.com/content/7/1/ 126 Page 2 of 5 make MA7 82- induced subcutaneously grown breast ade- nocar...

Ngày tải lên: 12/08/2014, 04:20

5 323 0

Báo cáo y học: " A novel small molecule target in human airway smooth muscle for potential treatment of obstructive lung diseases: a staged highthroughput biophysical screening" pps

... that dephosphorylate ADF/cofilin. Cell 20 02, 108 :23 3 -24 6. 24 . An SS, Hai CM: Mechanical signals and mechanosensitive modulation of intracellular [Ca2+] in smooth muscle. American Journal of Physiology-Cell Physiology ... KA performed statistical analysis; KA and SSA analyzed the data. JJF and SS oversaw the project. SSA wrote the paper. All authors read and approved the final ma...

Ngày tải lên: 12/08/2014, 13:22

9 496 0

Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx

... viability testing and RT-PCR analyses as well as the data for human cell lines are shown as mean values ± SEM (mean of standard error). Median values ± SEM were used for breast cancer samples due to ... monoclonal mouse-anti BrdU antibody (Dako, Glostrup, Denmark) and polyclonal rabbit antibody against human caspase-3 (cleaved) (DCS, Hamburg, Germany) were used in final dilutions of...

Ngày tải lên: 12/08/2014, 15:20

11 573 0