Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx
Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx
... low levels of CD4 T cell activation and reduced PBMC susceptibility to
HIV-1 infection in Central African EUs, indicating that both may contribute to the resistance to
HIV-1 infection.
Published: ... be
related to the apparent resistance to infection in this
group. From the studies conducted, we found lower levels
of CD4 T cell activation and...
Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx
... (6.3%)/16 asymp-
tomatic healthy carriers, 8 (61.5%)/13 symptomatic carri-
ers unrelated to HTLV-1 and 7(87.5%)/8 patients with
lymphoma-type ATL without circulating ATL cells. On
the other hand, in SBH ... status using the same blood samples. In
contrast to the maintenance of stable VL in asymptomatic
carriers with no-bands or only faint discrete bands, the
VL in symptomatic ca...
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... nonallergic
individuals.
To ensure uniformity in assessing the presence o f
symptoms of asthma, rhinitis or eczema between the
symptomatic and asymptomatic persons, the Interna-
tional Study of Asthma and ... a
written consent to participate in the study. The study
was approved by the Ethics Committee of the University
of Calgary.
Blood was drawn for allergen-sp ecific B/Th cell...
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... cited.
Abstract
Introduction The purpose of this study was to analyze the data
of patients with T- cell large granular lymphocyte (T- LGL)
lymphocytosis associated with inflammatory arthropathy or with
no ... granular lymphocyte (T- LGL) lymphocytosisHistopathological features of bone marrow in patients with arthritis and
T- cell large granular lymphocyte (T- LGL) lymphocytosis. (...
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
... AGGCTCATCCATTATTCAAATAC
BV14 GGGCTGGGCTTAAGGCAGATCTAC
BV15 CAGGCACAGGCTAAATTCTCCCTG
BV16 GCCTGCAGAACTGGAGGATTCTGG
BV17 TCCTCTCACTGTGACATCGGCCCA
BV18 CTGCTGAATTTCCCAAAGAGGGCC
BV19 TCCTCTCACTGTGACATCGGCCCA
BV20 ... On the other hand, the infiltration of T cells
in the synovial tissue and the demonstration that there is auto-
reactivity of T cells against type II collagen [10-13] suggest...
Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx
... ribonucleoproteins [5]. Consistently,
both TIA proteins directly bind to RNA as well as to single-
and double-stranded DNA [3-5]. It is tempting to speculate
that TIA proteins could also interact with ... therefore, they could interact with basal transcription
machinery and influence its activity. In addition, both pro-
teins contain three RNA-binding motifs and are structurally...
Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
... ecting the joints, skin,
kidneys and brain and is characterized by autoantibody
production by dysregulated B cells, target organ
in ltration by in ammatory T cells and aberrant immune
cell ... the signal
downstream into three distinct pathways. e adaptor
proteins bind and activate the enzyme PLCγ on one hand
and activate the Ras-mitogen-activated protein kinase
(MAPK) p...
Báo cáo y học: " Alteration of T cell immunity by lentiviral transduction of human monocyte-derived dendritic cells" pdf
... transduce DCs at high
efficiencies with little to no cytotoxicity, and the trans-
duced DCs retain their immature phenotype, are able to
respond to maturation signals, and maintain immunos-
timulatory ... co-stimulatory molecules in DCs,[32] a find-
ing that correlates with its ability to inhibit the primary T-
cell response and induce a stage of anergy in allo- or pep-
t...
báo cáo hóa học: " Persistently elevated T cell interferon-γ responses after treatment for latent tuberculosis infection among health care workers in India: a preliminary report" pot
... detect latent
tuberculosis infection (LTBI) was the tuberculin skin test
(TST). Although the TST is useful in clinical practice, it has
several known limitations, including variable specificity,
cross-reactivity ... drastically,
QFT-G reversions are unlikely, even after treatment. Sec-
ond, it is possible, that in HCWs repeatedly exposed to TB,
6 months of INH is inadequate to cle...
Báo cáo y học: " Comparative analysis of cell culture and prediction algorithms for phenotyping of genetically diverse HIV-1 strains from Cameroon" pps
... author
Abstract
Background: With the advent of entry inhibitors, monitoring of viral tropism in the clinical setting
is important. Conventional methods are cell- based and lengthy, therefore V3 ... sequencing are comparable with the
phenotypic method suggesting their potential applicabil-
ity in clinical settings for the future.
Another observation in our limited study is that among...