Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx
Báo cáo y học: " Reduced CD4 T cell activation and in vitro susceptibility to HIV-1 infection in exposed uninfected Central Africans" pptx
... low levels of CD4 T cell activation and reduced PBMC susceptibility to HIV-1 infection in Central African EUs, indicating that both may contribute to the resistance to HIV-1 infection. Published: ... be related to the apparent resistance to infection in this group. From the studies conducted, we found lower levels of CD4 T cell activation and...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx
... (6.3%)/16 asymp- tomatic healthy carriers, 8 (61.5%)/13 symptomatic carri- ers unrelated to HTLV-1 and 7(87.5%)/8 patients with lymphoma-type ATL without circulating ATL cells. On the other hand, in SBH ... status using the same blood samples. In contrast to the maintenance of stable VL in asymptomatic carriers with no-bands or only faint discrete bands, the VL in symptomatic ca...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... nonallergic individuals. To ensure uniformity in assessing the presence o f symptoms of asthma, rhinitis or eczema between the symptomatic and asymptomatic persons, the Interna- tional Study of Asthma and ... a written consent to participate in the study. The study was approved by the Ethics Committee of the University of Calgary. Blood was drawn for allergen-sp ecific B/Th cell...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... cited. Abstract Introduction The purpose of this study was to analyze the data of patients with T- cell large granular lymphocyte (T- LGL) lymphocytosis associated with inflammatory arthropathy or with no ... granular lymphocyte (T- LGL) lymphocytosisHistopathological features of bone marrow in patients with arthritis and T- cell large granular lymphocyte (T- LGL) lymphocytosis. (...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
... AGGCTCATCCATTATTCAAATAC BV14 GGGCTGGGCTTAAGGCAGATCTAC BV15 CAGGCACAGGCTAAATTCTCCCTG BV16 GCCTGCAGAACTGGAGGATTCTGG BV17 TCCTCTCACTGTGACATCGGCCCA BV18 CTGCTGAATTTCCCAAAGAGGGCC BV19 TCCTCTCACTGTGACATCGGCCCA BV20 ... On the other hand, the infiltration of T cells in the synovial tissue and the demonstration that there is auto- reactivity of T cells against type II collagen [10-13] suggest...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx
... ribonucleoproteins [5]. Consistently, both TIA proteins directly bind to RNA as well as to single- and double-stranded DNA [3-5]. It is tempting to speculate that TIA proteins could also interact with ... therefore, they could interact with basal transcription machinery and influence its activity. In addition, both pro- teins contain three RNA-binding motifs and are structurally...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
... ecting the joints, skin, kidneys and brain and is characterized by autoantibody production by dysregulated B cells, target organ in ltration by in ammatory T cells and aberrant immune cell ... the signal downstream into three distinct pathways. e adaptor proteins bind and activate the enzyme PLCγ on one hand and activate the Ras-mitogen-activated protein kinase (MAPK) p...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: " Alteration of T cell immunity by lentiviral transduction of human monocyte-derived dendritic cells" pdf
... transduce DCs at high efficiencies with little to no cytotoxicity, and the trans- duced DCs retain their immature phenotype, are able to respond to maturation signals, and maintain immunos- timulatory ... co-stimulatory molecules in DCs,[32] a find- ing that correlates with its ability to inhibit the primary T- cell response and induce a stage of anergy in allo- or pep- t...
Ngày tải lên: 13/08/2014, 13:20
báo cáo hóa học: " Persistently elevated T cell interferon-γ responses after treatment for latent tuberculosis infection among health care workers in India: a preliminary report" pot
... detect latent tuberculosis infection (LTBI) was the tuberculin skin test (TST). Although the TST is useful in clinical practice, it has several known limitations, including variable specificity, cross-reactivity ... drastically, QFT-G reversions are unlikely, even after treatment. Sec- ond, it is possible, that in HCWs repeatedly exposed to TB, 6 months of INH is inadequate to cle...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo y học: " Comparative analysis of cell culture and prediction algorithms for phenotyping of genetically diverse HIV-1 strains from Cameroon" pps
... author Abstract Background: With the advent of entry inhibitors, monitoring of viral tropism in the clinical setting is important. Conventional methods are cell- based and lengthy, therefore V3 ... sequencing are comparable with the phenotypic method suggesting their potential applicabil- ity in clinical settings for the future. Another observation in our limited study is that among...
Ngày tải lên: 10/08/2014, 05:21