Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
... constructed and characterized the HIV-1 viruses and lentiviral vectors used in the study. CS per- formed the analysis of DNA microarray data and per- formed the statistical analysis. AR conceived of the ... structure. To perform the analysis, we cal- culated the number of genes in the list annotated at or Validation of the microarray dataFigure 5 Validation of t...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Fosamprenavir or atazanavir once daily boosted with ritonavir 100 mg, plus tenofovir/emtricitabine, for the initial treatment of HIV infection: 48-week results of ALERT" potx
... data collection forms. KYS, WGW, ED, MAF, GEP, KAP and CTL evaluated the clinical data from the study, LLR per- formed the virological analysis, and QL performed the sta- tistical analysis. All ... Begley JA, Adda N, Kearney BP: Pharmacokinetics of tenofovir disoproxil fumarate and ritonavir-boosted saquinavir mesylate administered alone or in combination at steady state. Antimicrob...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Circumferential thoracolumbar corrective fusion with an anterior interbody fresh-frozen femoral head allograft for osteoporotic lower acute kyphosis: a case report" ppt
... IIjima-Nishibukuro, Akita 011-0948, Japan Email: Naohisa Miyakoshi* - miyakosh@doc.med.akita-u.ac.jp; Eiji Abe - abe-e@cna.ne.jp; Yoichi Shimada - yshimada@med.akita-u.ac.jp * Corresponding author Abstract Introduction: ... fully incorporated 1 year postoperatively. A new vertebral fracture at T10 occurred after 2 years, resulting in a slight loss of correction. A kyphosis angle o...
Ngày tải lên: 11/08/2014, 17:21
Tài liệu Báo cáo khoa học: Nop53p, an essential nucleolar protein that interacts with Nop17p and Nip7p, is required for pre-rRNA processing in Saccharomyces cerevisiae pdf
... h. (A) Total RNA separated on agarose gel after [ 3 H]uracil labeling. (B) Analy- sis on agarose gel of pre-rRNA labeled with [methyl- 3 H]methionine. (C) Total RNA separated on polyacrylamide ... [49] anti-U14 5¢-CTCAGACATCCTAGGAAGG-3¢ [28] anti-snR11 5¢-GACGAATCGTGACTCTG-3¢ [20] anti-snR37 5¢-GATAGTATTAACCACTACTG-3¢ [20] D. C. Granato et al. RNA processing in S. cerevisiae FEBS Journal .....
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo Y học: Induction of (2¢)5¢)oligoadenylate synthetase in the marine sponges Suberites domuncula and Geodia cydonium by the bacterial endotoxin lipopolysaccharide docx
... favor of a post-translational/allosterical activation of t he (2–5 )A synthetase. TheeffectofLPSonthesteady-statelevelofthe S. domuncula (2–5 )A synthetase transcripts was analyzed in tissue and ... it has been demonstrated that the expression of the (2–5 )A synthetase is mediated by the jak/STAT pathway and initiated by cytokines [28]. At present, studies on the elucid...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo y học: " Induction of multiple matrix metalloproteinases in human dermal and synovial fibroblasts by Staphylococcus aureus: implications in the pathogenesis of septic arthritis and other soft tissue infections" pdf
... compared with the untreated sample using Student's test. Sigma Stat (Systat Software, Inc., San Jose, CA, USA) program was used for statistical computation, and Sigma Plot (Systat Software, ... expression pattern of MAPK gene expres- sion also indicates the possibility of a signal transduction path- way akin to that induced by the inflammatory cytokine pathway. Our data a...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " Induction and effector phase of allergic lung inflammation is independent of CCL21/CCL19 and LT-beta
... [42] Yamashita N, Tashimo H, Matsuo Y, Ishida H, Yoshiura K, Sato K, Yamashita N, Kakiuchi T, Ohta K. Role of CCL21 and CCL19 in allergic inflammation in the ovalbumin-specific murine asthmatic ... Lack of lymphoid chemokines CCL19 and CCL21 enhances allergic airway in- flammation in mice. Int Immunol. 2007; 19:775-84. [45] Takamura K , Fukuyama S, Nagatake T, Kim DY, Kawamura A...
Ngày tải lên: 03/11/2012, 11:24
Báo cáo Y học: Induction of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI ) gene expression is mediated by ETS factor binding sites doc
... ETS TTCCTGT GACTGACTTGTCCGCACTAACAGCCGCCCCACAACAATATGAGGAGTTACAAATGCTTTATTAATAATCATT Nkx2. Nxk2. GAAGCATTGTTTGGAGTTTGAGCATCCTGGGAATAAAAATGATGAAAAAGGAAAAAGAGGATTGATTGGAAAGTTTAT TTTAAGATCATCTTTGGGATGAATAGGAATCATCGATTCGGATCGAATTTGTGGCAGTAGCTGCAGTTTCATGTGTGTG ... Nxk2. GAAGCATTGTTTGGAGTTTGAGCATCCTGGGAATAAAAATGATGAAAAAGGAAAAAGAGGATTGATTGGAAAGTTTAT TTTAAGATCATCTTTGGGATGAATAGGAATCATCGATTCGGATCGAATT...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo y học: "Interactions among type I and type II interferon, tumor necrosis factor, and -estradiol in the regulation of immune response-related gene expressions in systemic lupus erythematosus" potx
... analysis. CA performed labeling and scan- ning of the microarrays. YA assisted with data analysis. NY-H assisted with data analysis. KM assisted in microarray data acquirement. NN designed the study, ... purification, quantitative RT-PCR assays, and drafted of manuscript. TM performed data analysis, interpreta- tion of the microarray studies, and patient recruitment. HS assisted w...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: " Induction of IL-10-producing CD4+CD25+ T cells in animal model of collagen-induced arthritis by oral administration of type II collagen" pptx
... protein antigens that were repeatedly administered by oral feeding [1]. Induction of peripheral tolerance by oral administration of antigen has been applied to the treatment of autoimmune diseases ... type II collagen (CII) for induction of CIA. Mononuclear cells were isolated from the Peyer’s patch and the spleen, and production of IL-10 and TGF-β was assessed by sandwi...
Ngày tải lên: 09/08/2014, 01:23