Báo cáo y học: "Cost-effectiveness of activated protein C in real-life clinical practice" potx

Báo cáo y học: " Recombinant human activated protein C in acute lung injury: what is the role of bronchial circulation" docx

Báo cáo y học: " Recombinant human activated protein C in acute lung injury: what is the role of bronchial circulation" docx

... nonseptic origin. Low levels of protein C in acute lung injury are associated with poor clinical outcome. The present article discusses the beneficial effects of rhAPC in oleic acid-induced lung injury ... recombinant human activated protein C (rhAPC) in oleic acid-induced nonseptic acute lung injury (ALI) in sheep [1]. Impairment of the protein C pathway plays a...

Ngày tải lên: 13/08/2014, 11:23

2 550 0
Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx

Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx

... 5′ -TTTCCTCAATT TCTCCTCGG; UBE2D2-F, 5′-TGCCTGAGATTGCTCG- GATCTACA; UBE2D2-R, 5′ -ACTTCTGAGTC- CATTCCCGAGCTA; Tax-F, 5′ -ATGGCCCACTTC CCAGGGTTTGGA; Tax-R, 5′-ACCAGTCGCCTTGTA- CACAGTCTC; HBZ-S1-F, ... Primers 5′-GAAGATCTCATCGCCTCCAGCCTCCCCT and 5′- GAAGATCTGAGCAGGAGCGCCGTGAGCGCAAG, with inserted 5′ BglII sites were used to PCR amplify the HBZ fragment from pcDNA-HBZ-SP1-Myc [49]. Pri- mers GCT...

Ngày tải lên: 13/08/2014, 01:20

16 461 0
Báo cáo y học: "Endogenous plasma activated protein C levels and the effect of enoxaparin and drotrecogin alfa (activated) on markers of coagulation activation and fibrinolysis in pulmonary embolism." ppt

Báo cáo y học: "Endogenous plasma activated protein C levels and the effect of enoxaparin and drotrecogin alfa (activated) on markers of coagulation activation and fibrinolysis in pulmonary embolism." ppt

... Griffin JH: Anticoagulant synergism of heparin and activated protein C in vitro. Role of a novel anticoagulant mechanism of heparin, enhancement of inactivation of factor V by activated protein C. ... blood coagula- tion activation, activated protein C when bound to the endothelial protein C receptor (EPCR), activa- tes protease -activated receptors (PARs), i...

Ngày tải lên: 14/08/2014, 07:21

10 335 0
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx

Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx

... mitochondria can be differently affected by metabolic changes. Keywords: fasting; intermyofibrillar mitochondria; muscle type; subsacorlemmal; uncoupling protein- 3 (UCP3). The first uncoupling protein ... muscle mitochondria of UCP3 knockout (UCP3KO) mice [6,7] and of transgenic mice overexpressing UCP3 in their skeletal muscle [8] confirmed the uncoupling activity of UCP3. A more rece...

Ngày tải lên: 24/03/2014, 04:21

7 535 0
Báo cáo y học: "Recombinant human activated protein C attenuates endotoxin-induced lung injury in awake sheep" doc

Báo cáo y học: "Recombinant human activated protein C attenuates endotoxin-induced lung injury in awake sheep" doc

... Biochemistry, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, Norway 6 Department of Medical Physiology, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, ... with protein S, APC precludes generation of thrombin in a negative feedback loop by proteolytic cleavage of activated factors V and VIII. APC also escalates fibrino...

Ngày tải lên: 13/08/2014, 11:22

13 407 0
Báo cáo y học: "Recombinant human activated protein C ameliorates oleic acid-induced lung injury in awake sheep" pdf

Báo cáo y học: "Recombinant human activated protein C ameliorates oleic acid-induced lung injury in awake sheep" pdf

... G: Recom- binant human activated protein C upregulates cyclooxygenase-2 expression in endothelial cells via binding to endothelial cell protein C receptor and activation of pro- tease -activated ... as early immunologic effectors in hemorrhage- or endotoxemia- Key messages • In ovine oleic acid-induced lung injury, recombinant human activated protein C (rhAPC) amelio...

Ngày tải lên: 13/08/2014, 11:23

8 330 0
Báo cáo y học: "Recombinant human activated protein C attenuates cardiovascular and microcirculatory dysfunction in acute lung injury and septic shock" ppt

Báo cáo y học: "Recombinant human activated protein C attenuates cardiovascular and microcirculatory dysfunction in acute lung injury and septic shock" ppt

... hemodynamics in septic shock. • rhAPC attenuated changes in microcirculation in septic shock. Abbreviations ALI: acute lung injury; APC: activated protein C; BL: baseline; CO: cardiac output; COHb: carboxyhemoglobin; ... al.: Recombinant human activated protein C attenuates cardiovascular and microcirculatory dysfunction in acute lung injury and septic shock. Critical Care...

Ngày tải lên: 14/08/2014, 07:21

12 215 0
 Báo cáo y học: "Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus"

Báo cáo y học: "Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus"

... [17-20], hMMR deficiency has been studied predominantly in colorectal carcinomas. A distinct proportion of sporadic (and almost all hereditary) non-polyposis colorectal cancers exhibit hMSH2 ... situ and invasive carcinoma [26]. Stromal cells and their products, in association with insoluble intracellular matrix components, can act as an oncogenic agent, causing the disruption of...

Ngày tải lên: 03/11/2012, 09:54

6 461 0
Báo cáo y học: " Control of disseminated intravascular coagulation in Klippel-Trenaunay-Weber syndrome using enoxaparin and recombinant activated factor VIIa: a case report" pptx

Báo cáo y học: " Control of disseminated intravascular coagulation in Klippel-Trenaunay-Weber syndrome using enoxaparin and recombinant activated factor VIIa: a case report" pptx

... decrease the risk of bleeding, and the importance of a multidisciplinary approach in addition to intraoperative hemostatic proce- dures [10]. Once bleeding complications occur, identification of ... liver laceration. The interval of aminocarpoic acid administration is indicated by the dark grey bars. The initiation (arrow #2) and duration of administration of recombinant activa...

Ngày tải lên: 11/08/2014, 12:20

4 295 0
Báo cáo y học: " Level of dietary protein intake affects glucose turnover in endurance-trained men" doc

Báo cáo y học: " Level of dietary protein intake affects glucose turnover in endurance-trained men" doc

... ation of blood glucose when carbohydrate intake is reduced by serving as a gluconeogenic substrate in endurance-trained men. Introduction Increasing dietary protein at the expense of carbohy- drate ... study thereby minimizing the influence of energy needs on glucose disposal. Level of dietary protein can affect glucose utilization by: 1) influencing fasted and postprandial insu...

Ngày tải lên: 11/08/2014, 23:21

4 200 0
Từ khóa:
w