0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc

Báo cáo y học:

Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc

... input variables.BackgroundHospital information systems in intensive care medicine gener-ate large datasets on a daily basis. These rapidly increasingamounts of data make the task of extracting ... models for tacrolimus blood concentration canimprove clinical care by optimizing monitoring of theseconcentrations, especially in the initial phase after transplantation during intensive care unit ... fewer variables: only 2 input variables were used instead of 15 and 16 variables by the linear methods. Apparently,these 2 input variables contained more information in a nonlin-ear way than the...
  • 7
  • 318
  • 0
Báo cáo y học:

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

... therapy. Afterestablishing of mass vaccination programmes withinmany industrialized countries, primary and secondaryvaccine failures have occurred in parallel with the obser-vation of waning immunity ... in their second year of life. The introduction of universal varicella vaccination has sub-stantially reduced varicella related morbidity and mortal-ity [2,3]. Varicella v accine was originally ... of the latter overnight culture and incubated in a bacterial shaker for 3 hat 37°C before addition of IPTG to a final concentration of 1 mM and an additiona l shaking for 6 h at 37°C. The indu...
  • 9
  • 750
  • 0
Báo cáo y học:

Báo cáo y học:A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx

... appear to play key roles in the pathogenesis of RA, and the co-ordinated production of chemokines andproinflammatory cytokines is probably important in the orchestration of the inflammatory responses ... ultraviolet transillumination.Statistical analysisData were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; AbacusConcept Inc, Berkeley, CA, USA) and expressed ... demonstrated that the secretion of a potentangiogenic factor, namely vascular endothelial growthfactor, was markedly induced by the interaction of FLSwith synovial leukocytes via the integrin/ICAM-1...
  • 8
  • 446
  • 0
Báo cáo y học:

Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

... deSherbrooke.Detection of matrix metalloproteinases by zymography The gelatinase activity of SF was determined as previouslydescribed [15]. The gelatinolytic activity was measured in arbi-trary units by quantitative ... members of the MMP family is the hall-mark of several inflammatory disorders, including arthritis.MMP-9, in particular, has been implicated in the degradationand damage of articular cartilage in ... in synovial fluids of inflammatory arthritis patients correlates with the inflammatory state of the diseaseExtracellular proteases are secreted in SF by infiltrating inflam-matory cells and/or...
  • 10
  • 494
  • 0
Báo cáo y học:

Báo cáo y học: "A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data" pot

... amplification8 5 (AAAAA, AA), (AAABB, AB), (AABBB, AB), (BBBBB, BB) 5n unbalanced amplification9 6 (AAAAAA, AA), (AAAAAB, AB), (ABBBBB, AB), (BBBBBB, BB) 6n unbalanced amplification10 6 (AAAAAA, AA), ... 2n somatic LOH13 3 (AAA, AA), (AAA, AB), (BBB, AB), (BBB, BB) 3n somatic LOH14 4 (AAAA, AA), (AAAA, AB), (BBBB, AB), (BBBB, BB) 4n somatic LOH15 5 (AAAAA, AA), (AAAAA, AB), (BBBBB, AB), (BBBBB, ... (B, AB), (B, BB) Hemizygous deletion3 2 (AAAA, AA), (AAAB, AB), (ABBB, AB), (BBBB, BB) Normal4 3 (AAA, AA), (AAB, AB), (ABB, AB), (BBB, BB) Single copy duplication5 4 (AAAA, AA), (AAAB, AB),...
  • 15
  • 583
  • 0
Báo cáo y học:

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

... and stay in close contact with the surface andthen eventually attach. This is akin to the attachment of monocytes rolling along the walls of blood vessels in the body during extravasation into ... bottles. The cells werematured over two days, harvested and analyzed for cell yield and mature DC phenotype by flowcytometry, and then functionally analyzed for their ability to activate allogeneic ... and CD86 and analyzed by flow cytometry. In each case all the isolated floating cells were analyzed without gating and phenotype of DC compared between the roller bottles and static flask system....
  • 11
  • 469
  • 0
Báo cáo y học:

Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

... further aggravated by tiptoeing and weightbearing maneuvers. Again, US examination in the proneposition did n ot reveal any abnormal sonographicfindings.After two normal sonographic findings ... ultrasound examination approach was then performed with the patient lying in the supineposition with his knee flexed at 90 degrees. The transducer was then placed pointing upwards toexamine the ... [1,4].When using US to examine patients suspected of havingcalf muscle strains, patients are usually placed in the proneposition for better viewing of the longitudinal andtransverse muscle planes...
  • 4
  • 316
  • 0
Báo cáo y học:

Báo cáo y học: "A novel method for purifying bluetongue virus with high purity by co-immunoprecipitation with agarose protein A" ppsx

... Lab. of Molecular Virus & Cancer, State Key Laboratory of Virology, Wuhan University School of Basic Medicine, Wuhan University, Wuhan 430071, ChinaFull list of author information is available ... used as a criterion to measure whether the purified virus was still active enough. As the infecting days went by, the number of wells ap-peared 50% CPE was increasing. The curvilinear trend of ... virions can be observed and they were sur-rounded with a mass of cell debris (Fig. 1A &1B). On the contrary, the photograph of purified sample revealed the purity and integrity of virus. In fact,...
  • 5
  • 322
  • 0
Báo cáo y học:

Báo cáo y học: " A novel function for spumaretrovirus integrase: an early requirement for integrase-mediated cleavage of 2 LTR circles" docx

... end65substrateCAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAACAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAACAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAACAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGAGAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCCCAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG****************- ... endonucleolytic action of IN at an earlystep would explain many of the phenotypes associatedwith IN mutations, including the increasing abundance of 2-LTR molecules at the expense of linear and integratedDNA ... pro-teins, since they localize to cell nuclei in the absence of any other viral protein. Nuclear accumulation of INs maybe a general feature of retroviruses. The intrinsic kary-ophilic property of retrovirus...
  • 18
  • 321
  • 0
Báo cáo y học:

Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

... process information.Information in the form of software abstraction also includes the organization of thatinformation, as opposed to a physical object. The software aspect o f the centralizedinformation-processing ... What keeps all these pathways from executing is inhibition; a series of information processing brakes that are maintained in place. An analogy that comesto mind is the management of a river system ... Watson and Crick role of DNA as an informationrepository for protein synthe sis; therefore the majority of human DNA appears tooperate outside the traditional paradigm of the Central Dogma...
  • 29
  • 420
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyena novel approach for post stroke aphasic patientsa novel approach for genetic immunizationearly memory loss clubs a novel approach for stimulating and sustaining cognitive functiona novel notch effector for maintenance of neural progenitor cells in the neocortexbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam