Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc
... input variables. Background Hospital information systems in intensive care medicine gener- ate large datasets on a daily basis. These rapidly increasing amounts of data make the task of extracting ... models for tacrolimus blood concentration can improve clinical care by optimizing monitoring of these concentrations, especially in the initial phase after transpl...
Ngày tải lên: 13/08/2014, 08:20
... therapy. After establishing of mass vaccination programmes within many industrialized countries, primary and secondary vaccine failures have occurred in parallel with the obser- vation of waning immunity ... in their second year of life. The introduction of universal varicella vaccination has sub- stantially reduced varicella related morbidity and mortal- ity [2,3]. Varicella...
Ngày tải lên: 12/08/2014, 04:20
... appear to play key roles in the pathogenesis of RA, and the co-ordinated production of chemokines and proinflammatory cytokines is probably important in the orchestration of the inflammatory responses ... ultraviolet transillumination. Statistical analysis Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus Concept...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... de Sherbrooke. Detection of matrix metalloproteinases by zymography The gelatinase activity of SF was determined as previously described [15]. The gelatinolytic activity was measured in arbi- trary units by quantitative ... members of the MMP family is the hall- mark of several inflammatory disorders, including arthritis. MMP-9, in particular, has been implicated in the...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A statistical approach for detecting genomic aberrations in heterogeneous tumor samples from single nucleotide polymorphism genotyping data" pot
... amplification 8 5 (AAAAA, AA), (AAABB, AB), (AABBB, AB), (BBBBB, BB) 5n unbalanced amplification 9 6 (AAAAAA, AA), (AAAAAB, AB), (ABBBBB, AB), (BBBBBB, BB) 6n unbalanced amplification 10 6 (AAAAAA, AA), ... 2n somatic LOH 13 3 (AAA, AA), (AAA, AB), (BBB, AB), (BBB, BB) 3n somatic LOH 14 4 (AAAA, AA), (AAAA, AB), (BBBB, AB), (BBBB, BB) 4n somatic LOH 15 5 (AAAAA, AA), (AAAAA, AB), (BBBBB, AB),...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... and stay in close contact with the surface and then eventually attach. This is akin to the attachment of monocytes rolling along the walls of blood vessels in the body during extravasation into ... bottles. The cells were matured over two days, harvested and analyzed for cell yield and mature DC phenotype by flow cytometry, and then functionally analyzed for their abil...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx
... further aggravated by tiptoeing and weight bearing maneuvers. Again, US examination in the prone position did n ot reveal any abnormal sonographic findings. After two normal sonographic findings ... ultrasound examination approach was then performed with the patient lying in the supine position with his knee flexed at 90 degrees. The transducer was then placed pointing upwards t...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: "A novel method for purifying bluetongue virus with high purity by co-immunoprecipitation with agarose protein A" ppsx
... Lab. of Molecular Virus & Cancer, State Key Laboratory of Virology, Wuhan University School of Basic Medicine, Wuhan University, Wuhan 430071, China Full list of author information is available ... used as a criterion to measure whether the purified virus was still active enough. As the infecting days went by, the number of wells ap- peared 50% CPE was increasing. The...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " A novel function for spumaretrovirus integrase: an early requirement for integrase-mediated cleavage of 2 LTR circles" docx
... end 6 5 substrate CAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAA CAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAA CAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAA CAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGA GAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCC CAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG * * * * * * * * * * * * * * * * - ... endonucleolytic action of IN at an early step would explain many of the phenotypes associa...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc
... process information. Information in the form of software abstraction also includes the organization of that information, as opposed to a physical object. The software aspect o f the centralized information-processing ... What keeps all these pathways from executing is inhibition; a series of information processing brakes that are maintained in place. An analogy that come...
Ngày tải lên: 13/08/2014, 16:20