a novel approach for post stroke aphasic patients

... creatinine [CR] and urea [UR]) or liver dysfunction (alanine aminotransferase [ALT], aspartate aminotransferase [AST], gamma-glutamyl transpeptidase [GGT], total and conjugated bilirubin, alkaline ... the total amount of available data Variable selection for the MLR model In the MLR model also, the variable selection was performed with a forward, a backward, and a stepwise algorithm for simple ... input variables Background Hospital information systems in intensive care medicine generate large datasets on a daily basis These rapidly increasing amounts of data make the task of extracting...

Ngày tải lên: 13/08/2014, 08:20

... vision, as others have also adopted this strategy as a way forward in molecular analysis Alagaratnam et al are utilising Bayesian approaches to pursue muscular dystrophy diagnosis [223] Similarly, ... 17(5):323-329 Ito M, Nakamura F, Baba A, Tamada K, Ushijima H, Lau KHA, Manna A, Knoll W: Enhancement of surface plasmon resonance signals by gold nanoparticles on high-density DNA microarrays J Phys Chem ... Iio K, Tanimoto Y, Kanehiro A, Okada C, Soda R, Takahashi K, Tanimoto M: Inflammatory markers in exhaled breath condensate from patients with asthma Respirology 2008, 13(5):654-663 Fagan KA, McMurtry...

Ngày tải lên: 12/08/2014, 14:20

... of an Adaptive Mixed Reality Rehabilitation (AMRR) system for a reach and grasp action Preliminary data from a study employing the AMRR system has demonstrated the system’s ability to facilitate ... of customizable approaches to stroke rehabilitation Interactive rehabilitation also demands detailed, quantitative, real-time evaluation to reveal to the participant the state of his action network ... form the basis for quantifiable, adaptive, manageable re-learning of the relationships among action goal, activity and body functions within interactive stroke rehabilitation For this abstraction...

Ngày tải lên: 19/06/2014, 08:20

... control-oriented functionality (an ARM for the signalling part and a StarCore for the multimedia part) It features several hardware accelerating units (ASICs), for the more data-oriented and computation intensive ... directed acyclic graph (DAG) The objective function incorporates several constraints on the available silicon area (hardware capacity), B Knerr et al memory (software capacity), and latency as a timing ... constraints like time, area, power, throughput, delay, and so forth Hardware then usually addresses the implementation of a functional part, for example, performing an FIR or CRC, as a dedicated hardware...

Ngày tải lên: 22/06/2014, 06:20

... K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative hemihepatic portal vein ... Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number not for ... 21:434-439 Makuuchi M, Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile...

Ngày tải lên: 09/08/2014, 04:21

... metalloproteinase (96-kd gelatinase B) in human rheumatoid arthritis Arthritis Rheum 1996, 39:1576-1587 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... La Fondation Armand-Frappier and the Canadian Arthritis Network 16 17 References Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular ... MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and OA [2-4]...

Ngày tải lên: 09/08/2014, 08:22

... conventional fashion Echocardiography All patients will have standard two-dimensional echocardiographic examinations before and after AVR LV ejection fraction is assessed visually by a trained echocardiographer ... this article as: Guerra et al.: Rationale, design and methodology for Intraventricular Pressure Gradients Study: a novel approach for ventricular filling assessment in normal and falling hearts ... that systolic and diastolic IVPG, a marker of normal left ventricular function, may be related to physiological asynchrony between basal and apical myocardial segments and that they can be attenuated,...

Ngày tải lên: 10/08/2014, 09:21

... codon)-3’ and the “second round PCR” (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing ... in large scale as described by Soutscheck et al [12], rearranged in line assay format and validated with a number of pre-characterized serum samples These validation data confirmed the seroreactivity ... assays, data analysis and Page of wrote the manuscript KIP carried out large scale protein purification, microarray screen, line development and data analysis, participated in the coordination of...

Ngày tải lên: 12/08/2014, 04:20

... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach s accompanying high rate of false positives There are ... for IdM, Privacy and Identity Management for Europe (PRIME), Windows CardSpace, and OpenID Also they propose an entity-centric approach for IdM in the cloud that based on active bundles and anonymous ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous...

Ngày tải lên: 31/07/2013, 09:43

... the Dakar Framework for Action during the World Education Forum (Dakar, 2000) are revitalising efforts to achieve Education for All In developing National Action Plans to achieve the goals and ... community, and take advantage of a skilled workforce (teachers and administrators) that is already engaged with individual and organisational partners in the local community As students become healthier, ... planners, administrators and teachers, at the local as well as national level, can participate in and benefit from this exchange 11 Systematically monitor progress towards EFA goals and strategies at...

Ngày tải lên: 14/02/2014, 09:20

... Ethiopia Mr B.S Samarasiri, Moratuwa University, Sri Lanka Prof Dr John Turyagyanda, Makerere University, Uganda Dr Sonia Valdivia, UNEP DTIE, France Design and lay-out Ms Ana Mestre and Ms Gra a Campelo, ... Austria Mr Samantha Kumarasena, NCPC, Sri Lanka Mr Nguyen Hong Long, NCPC,Vietnam Ms Sophie Loran, UNEP DTIE, France Dr Diego Masera, UNEP Regional Office for Latin America and the Carribbean, ... spread as seen in the number of manuals and sectorspecific supporting materials that are available in many languages As a result, and based on experience, Ecodesign has evolved to encompass broader...

Ngày tải lên: 21/02/2014, 05:20

... Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard, which was quantified at ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... medium for 30 For HPLC analyses, cells were harvested after h, and carotenoids were extracted and processed as described above Analytical methods For HPLC analyses, a Waters system equipped with a...

Ngày tải lên: 07/03/2014, 03:20

... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with ... Hayakumo T & Nakajima M (1996) Expression of cathepsin E in pancreas: a possible tumor marker for pancreas, a preliminary report Int J Cancer 67, 492–497 22 Uno K, Azuma T, Nakajima M, Yasuda...

Ngày tải lên: 07/03/2014, 09:20

Ngày tải lên: 07/03/2014, 15:20

... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate ... of the available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor they parallel the findings on the noncanonical class IIIc AC Rv1900c ... because the canonical amino acids which define substrate specificity are replaced in a nonconservative manner, glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs...

Ngày tải lên: 07/03/2014, 21:20

... Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address Postfach ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... Gambacorta, L and Marqués-Ibañez, D (2008), "Securitisation and the bank lending channel", European Economic Review (forthcoming) [3] Altunbas, Y., Gambacorta, L and Marqués-Ibañex (2009), "Bank...

Ngày tải lên: 15/03/2014, 10:20

... estudo exploratório dos fatores de marketing que contribuem para a sua ocorrência em indústrias alimentícias paulistanas (Dissertation: Master in Administração) Mackenzie, São Paulo (in Portuguese) ... greater risk the last one Currently, presumed private label brands account for a significant share of sales of retailers, particularly in the area of food The growth in size and share of own brands ... organizations that can cause cannibalism without benefits These instances related to top management decisions or the management practices of their products that include: a) strong top management...

Ngày tải lên: 16/03/2014, 11:20

... L9 [2] H Sahaf, L Masson, C Leandri, B Auffray, G Le Lay, F Ronci, Appl Phys Lett 90 (2007) 263110 [3] M .A Valbuena, J Avila, M.E Davila, C Leandri, B Aufray, G Le Lay, M.C Asensio, Appl Surf ... filled states STM images of the surface following the evaporation of Å of THAP are displayed in Fig 3a and b Each molecule appears as a six-pronged shape with six bright lobes and a dark center ... structure as that observed upon adsorption on a clean Ag(1 0) surface [10] The reactivity of the Ag surface is presumably locally modified by the SiNWs, possibly by the formation a 2D surface Si–Ag alloy,...

Ngày tải lên: 16/03/2014, 15:35

... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in vitro ... drinking water taken orally twice a day The usual dose of Ca3(PO4)2 prescribed was grains (~0.324 g) taken orally twice a day Clinical features of patients with intracranial brain cancers The 15 patients ... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and...

Ngày tải lên: 22/03/2014, 17:20

... and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and ... The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted ... DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the NotI–SacI site of pLMZ -WT and pLMZ-K3 5A, yielding plasmids pLMZ-WT-H and...

Ngày tải lên: 22/03/2014, 21:20