Báo cáo y học: "Vasopressin improves survival in a porcine model of abdominal vascular inj" ppt
... placebo on haemodynamic variables and short-term survival in an abdominal vascular injury model with uncontrolled haemorrhagic shock in pigs. Methods During general anaesthesia, a midline laparotomy ... com- parability of baseline data was verified using one-way analysis of variance. Survival rates were compared using Kaplan-Meier methods with log rank (Mantel Cox) compari...
Ngày tải lên: 13/08/2014, 08:20
... Y, Yamazaki K, Sato T, Karino Y, Toyota J, Suga T, Asaka M: Clinical features of hepato- cellular carcinoma with extrahepatic metastases. J Gastroen- terol Hepatol 2005, 20:1781-1787. 15. Aramaki ... hepatocellular carcinoma in lung parenchyma (original magnification ×40). Abdominal computed tomography on admission showing a mass in Couinaud segment 7 and segment 8 of the liver...
Ngày tải lên: 11/08/2014, 21:22
... Soldatos 1 , Dimitrios Karakitsos 2 , Katerina Chatzimichail 1 , Matilda Papathanasiou 1 , Athanasios Gouliamos 1 and Andreas Karabinis 2 1 Second Department of Radiology, Attikon University ... 18 years old) were included in the study. Fifty patients suffered from brain injury, whereas 26 had no intracranial pathology and served as control individuals. Initially, brain-injured patients...
Ngày tải lên: 13/08/2014, 11:22
Báo cáo y học: "Hepatic oxidative stress in an animal model of sleep apnoea: effects of different duration of exposure" potx
... sham intermittent hypoxia group; IH-21: intermittent hypoxia for 21 days; IH-35: intermittent hypoxia for 35 days; AST: aspartate aminotransferase; ALT: alanine aminotransferase ; ALP: alkaline ... 50% of epinephrine auto-oxidation was defined as 1 U of SOD activity. The analysis of CAT activity is based on measuring the decrease in hydrogen peroxide [32]. Catalase activity was determ...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation" pdf
... 4 :17. 11. Koura T, Hara M, Takeuchi S, Ota K, Okada Y, Miyoshi S, Watanabe A, Shiraiwa K, Mitamura H, Kodama I, Ogawa S: Anisotropic con- duction properties in canine atria analyzed by high-resolu- tion ... Access Research Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation Nicholas Sperelakis 1 and Lakshminarayanan Ramasamy* 2 Add...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: "iagnostic Markers based on a Computational Model of Lipoprotein Metabolism" ppsx
... from a group because of a lack of steady state in the data (in- and efflux balance), individual subjects are mentioned. - 17 - The calibrated model produced an analysis of lipoprotein kinetics ... during the - 20 - k a, apoB rate at which liver binding mediated by apoB takes place A shape constant for liver binding mediated by apoE B shape parameter for liver bind...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo khoa học: "Vasopressin improves outcome in out-of-hospital cardiopulmonary resuscitation of ventricular fibrillation and pulseless ventricular tachycardia: a observational cohort study" ppsx
... myocardial ATP with proar- rhythmic effects [2], and increases myocardial lactate level [3- 5,23]. Prehospital administration of adrenaline appears to be of little value in increasing rates of ... cardiac arrest in the prehospital setting. Our findings strongly support combined administration of vasopressin and adrenaline during CPR among patients in VF/ VT arrest caused by myoc...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"
... resuscitation of criti- cally ill or injured adult and paediatric patients [1,2]. It can be challenging to obtain vascular access, especially in the resuscitation of small children in emergency situations ... Heltne 1,2,3 Abstract Background: Intraosseous access (IO) is a method for providing vascular access in out -of- hospital resuscitation of critically ill and injured pa...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx
... forward and reverse primers were ATGGG TAAGAAGAAGGGAGGA and TCTCTTTGCTCGGA CGCG, respectively. For sPsbW, the forward and reverse primers were ATGGAGACAAAGCAAGGAAAC and TCTCTATTTGCTCGGACGCG. All ... (H-domain) and more polar carboxyterminal region (C-domain) ending with an Ala-Xaa-Ala consensus region. Signal peptides usually specify translocation by Sec-type translocation systems in the en...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... multiplicity of infection; ELISA: enzyme-linked immunosorbant assay; TUNEL: terminal deoxynecleotidyl transferase- mediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; ... liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5). Taking all these data into consideration, it appears t hat combina- tio...
Ngày tải lên: 18/06/2014, 19:20