Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

Báo cáo y học: " MDM2 is a novel E3 ligase for HIV-1 Vif" pot

... Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan, 7 Central Pharmaceutical Research Institute, Japan Tobacco Inc., 1-1 Murasaki-cho, Takatsuki, Osaka 569-1125, Japan, 8 Laboratory of Disease ... Hirofumi Akari 8 , Yoshio Koyanagi 9 , Jun Fujita 3 and Takashi Uchiyama 1 Address: 1 Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho...

Ngày tải lên: 13/08/2014, 05:21

12 692 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic ... our study for the first time tenta- tively supports the hypothesis that a mechanism thorough which abnormal metabolism may ultimately influence ALS pathogenesis is through mecha...

Ngày tải lên: 03/11/2012, 10:52

8 503 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC (b) t WGFTLKG...

Ngày tải lên: 09/08/2014, 23:20

36 447 0
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps

Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps

... Masahiko Takahashi - masahiko@med.niigata-u.ac.jp; Masayasu Oie - moie@med.niigata-u.ac.jp; Yuetsu Tanaka - yuetsu@s4.dion.ne.jp; Yutaka Aoyagi - aoy@med.niigata-u.ac.jp; Masahiro Fujii* - fujiimas@med.niigata-u.ac.jp * ... Tax2 Toshiyuki Shoji †1,2 , Masaya Higuchi †1 , Rie Kondo 1 , Masahiko Takahashi 1 , Masayasu Oie 1 , Yuetsu Tanaka 3 , Yutaka Aoyagi 2 and Masahiro Fujii* 1 Address:...

Ngày tải lên: 12/08/2014, 23:22

11 548 0
Báo cáo y học: "Establishment of a novel CCR5 and CXCR4 expressing line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists" pdf

Báo cáo y học: "Establishment of a novel CCR5 and CXCR4 expressing line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists" pdf

... T-cell- line-adapted HIV-1. Nature 1996, 382:833-835. 18. Baba M, Nishimura O, Kanzaki N, Okamoto M, Sawada H, Iizawa Y, Shiraishi M, Aramaki Y, Okonogi K, Ogawa Y, Meguro K, Fujino M: A small-molecule, ... Padmanabhan S, Martellucci SA, Henson GW, Abrams MJ, Yamamoto N, De Vreese K, Pauwels R: Synthesis and structure-activity relationships of phe- nylenebis(methylene)-linked bis-tetra...

Ngày tải lên: 13/08/2014, 13:20

13 395 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

... 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients. Anesth Analg 2005, 101:1470-1476. 28. ... evalu- ated by the chi-square test for categorical variables. Comparison of group differences for continuous variables was carried out by one-way analysis of varianc...

Ngày tải lên: 25/10/2012, 10:35

10 598 0
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx

... Science, Technology and Medicine, London SW7 2AZ, UK; 2 Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, Japan Sugar conjugation is a major pathway for the inactivation and excretion ... haemocytes) was isolated by the guanidinium thiocyanate method [17]. Integument samples may have contained small amounts of muscle and tracheal tissue also. Bmugt1 expression was s tu...

Ngày tải lên: 22/02/2014, 04:20

7 471 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGT...

Ngày tải lên: 07/03/2014, 15:20

8 485 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... such as bundles and cables, is crucial to stabilize the organiza- tion of transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation ... pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (C) Quantitation analysis for GST–hhLIM association with F-actin at different concent...

Ngày tải lên: 16/03/2014, 06:20

11 347 0
Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx

Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx

... 5'-ACCAGAGGCATAC AGGGACAA-3' IFN-γ 5'-GAAAGACAACCAGGCCATCAG-3' 5'-TCATGAATGCATCCTTTTTTGC-3' IL-4 5'-CCACGGAGAACGAG CTCATC-3' 5'-GAGAACCCCAGACTTGTTCTTCA-3' IL-17 ... Tamura T, Udagawa N, Takahashi N, Miyaura C, Tanaka S, Yamada Y, Koishihara Y, Ohsugi Y, Kumaki K, Taga T, Kishimoto T, Suda T: Soluble interleukin-6 receptor triggers osteoclas...

Ngày tải lên: 09/08/2014, 13:22

11 375 0
Từ khóa:
w