Báo cáo khoa học: "Kidney function assessment in the critically ill child: is it time to leave creatinine behind" pot

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specifici...

Ngày tải lên: 14/02/2014, 14:20

... for Metabolic gene switching in murine female heart M. F. Essop et al. 5282 FEBS Journal 274 (2007) 52785284 ê 2007 The Authors Journal compilation ª 2007 FEBS Metabolic gene switching in the murine ... Cooksey RC, McClain DA, Litwin SE et al. (2002) Insulin signaling coordinately M. F. Essop et al. Metabolic gene switching in murine female heart FEB...

Ngày tải lên: 18/02/2014, 16:20

... integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling. Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... 2007 The Authors Journal compilation ª 2007 FEBS MINIREVIEW Osmosensing and signaling in the regulation of mammalian cell function Freimut Schliess, Roland Rein...

Ngày tải lên: 18/02/2014, 16:20

... Mu ă ller V (2007) An intermediate step in the evolution of ATPases – the F 1 F 0 -ATPase from Aceto- bacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis. FEBS ... Journal 275 (2008) 19992007 ê 2008 The Authors Journal compilation ª 2008 FEBS An intermediate step in the evolution of ATPases – a hybrid...

Ngày tải lên: 18/02/2014, 17:20

... Follistatin, Chordin and Noggin [12]. These proteins are antagonists of BMP and other members of the TGF-b family, binding to and inhibit- ing these signaling molecules from binding to their receptors ... BMPs in the early development of zebrash FEBS Journal 274 (2007) 29602967 ê 2007 The Author Journal compilation ê 2007 FEBS 2963 MINIREVIEW Bone morphogenetic prote...

Ngày tải lên: 19/02/2014, 00:20

... integral membrane proteins from the mitochondrial outer membrane, and of the 11 most abundant integral proteins, 10 had a-helical transmem- brane segments. Of these 10 proteins, most had a single ... trans- membrane segments that are assembled into the mito- chondrial outer membrane. Results and Discussion Integral membrane proteins in the mitochondri...

Ngày tải lên: 19/02/2014, 07:20

... report the results of a study, combining tran- scriptomic and proteomic approaches, designed to increase our knowledge of the structure and function of oyster MTs in the American oyster, C. virginica, ... between the a- and b-domains of invertebrate and vertebrate domains would require an inversion within the MT gene of the a and b encoding segments,...

Ngày tải lên: 30/03/2014, 13:20

... I). Original article Metabolism of isopentenyladenosine in the roots of Norway spruce seedlings exposed to nutritive stress K von Schwartzenberg M Bonnet-Masimbert P Doumas INRA, ... roots of the stressed seedlings. Results are discussed with regard to the levels of endogenous cytokinins measured in spruce affected by the novel t...

Ngày tải lên: 08/08/2014, 19:21

... agreement with the intent of the legislation but highly critical of the legis- lation in its current form. The barriers highlighted by civil society were consistent with those cited by the generic drug ... 1999, 14:115-1 26. BioMed Central Page 1 of 9 (page number not for citation purposes) Globalization and Health Open Access Research Canada's implementation of th...

Ngày tải lên: 11/08/2014, 14:21

... stimulates Commentary Role of iron in anaemic critically ill patients: it’s time to investigate! Michael Piagnerelli 1 and Jean-Louis Vincent 2 1 Resident, Department of Intensive Care, Erasme ... common problem in critically ill patients admitted to intensive care units. Many factors can be involved in its development, including rapid alterations in iron...

Ngày tải lên: 12/08/2014, 20:20

... translates into a number needed to treat of five patients. The early advantage of relative haemodynamic stability at intubation, which itself is not an important patient-centred outcome and can ... these patients are treated with cortico- steroids [9]. Other critically ill patients without septic shock may also be at risk but the data are observational and weaker [8]. There ca...

Ngày tải lên: 13/08/2014, 03:20

... laboratorial diagnosis of AF with norepinephrine removal in patients with septic shock. Patients and methods Patients This prospective and noninterventional study was carried out in an ICU of a tertiary ... regarding Δmax 249 ≤ 9 μg/dl was not influenced by serum albumin levels. These findings highlight the importance of measuring the adrenal gland reserve (Δmax) Table 2 A...

Ngày tải lên: 13/08/2014, 03:20

... Corstjens and colleagues [1], yields glucose results dependent on hemato- Commentary Blood glucose measurements in the critically ill: more than just a blood draw Frank M Brunkhorst 1 and Hans G Wahl 2 1 Department ... While data about the beneficial effects of normoglycemia in critically ill patients are conflicting and inconsistent [2,3], there is no doubt ab...

Ngày tải lên: 13/08/2014, 03:20

... is therefore the first report of non -creatinine- based methods to estimate renal function in critically ill pediatric patients with AKI. The rationale for assessing AKI markers in critically ill ... for longitudinal assessment of baseline renal function. The accurate diagnosis of acute kidney injury (AKI) is especially problematic in critically ill patients...

Ngày tải lên: 13/08/2014, 03:21

... exist. This was a period when if one wished to learn what was being pub- lished, one had to reach for the weekly/monthly periodi- cals (that often meandered through the postal service sometimes, ... spotlights what IF in part does and does not convey. With that disclaimer, how is Retrovirology doing IF-wise as the journal enters its fourth year? Employing the algorithm that IF derives...

Ngày tải lên: 13/08/2014, 05:22