Báo cáo khoa học: "Kidney function assessment in the critically ill child: is it time to leave creatinine behind" pot

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... subcellular fractionationTo analyze the cellular localization of zebraﬁshRPE65c in the retina, we generated an antibody using a speciﬁc zebraﬁsh RPE65c peptide, and the speciﬁcity of the antibody was ... system (AlphaIn-notech, San Leandro, CA, USA). The bands (inten-sity · area) were semi-quantiﬁed by densitometry usingALPHAVIEW Q software (AlphaInnotech), and averaged fromat least three independent...

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... for Metabolic gene switching in murine female heart M. F. Essop et al.5282 FEBS Journal 274 (2007) 52785284 ê 2007 The Authors Journal compilation ª 2007 FEBS Metabolic gene switching in the murine ... Cooksey RC, McClain DA,Litwin SE et al. (2002) Insulin signaling coordinatelyM. F. Essop et al. Metabolic gene switching in murine female heart FEBS Journal 274 (2007) 52785284 ê 2007 The Authors ... gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress M. Faadiel Essop1,2, W. Y. A. Chan2and Heinrich Taegtmeyer31...

Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx

... integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling. Similarly, sensing of glutamine-induced hepatocyte swelling by integrinsfeeds into ... 2007 The Authors Journal compilation ª 2007 FEBS MINIREVIEW Osmosensing and signaling in the regulation of mammalian cell function Freimut Schliess, Roland Reinehr and Dieter HaăussingerClinic ... cell volume to a functional outcome.This minireview summarizes recent progress in the understanding of how osmosensing and osmosignaling integrate into the overall context of growthfactor signaling...

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... Muăller V (2007) An intermediate step in the evolution of ATPases – the F1F0-ATPase from Aceto-bacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis. FEBS ... Journal 275 (2008) 19992007 ê 2008 The Authors Journal compilation ª 2008 FEBS An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+F1F0 ATP synthase Michael ... V1V0 ATPases has only half the number of ion-binding sites compared to F1F0 ATP syntheses.This low H+(Na+) ⁄ ATP ratio is apparently the reasonfor the inability of eukaryal V1V0ATPases...

Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebraﬁsh pptx

... Follistatin, Chordin and Noggin[12]. These proteins are antagonists of BMP and othermembers of the TGF-b family, binding to and inhibit-ing these signaling molecules from binding to theirreceptors ... BMPs in the early development of zebrashFEBS Journal 274 (2007) 29602967 ê 2007 The Author Journal compilation ê 2007 FEBS 2963 MINIREVIEW Bone morphogenetic proteins in the early development of ... theirreceptors in the extracellular space, thus inhibiting ven-tralizing activities. Of these proteins, Chordin has along-range effect. In Xenopus, expression of the chordingene is localized to the dorsal...

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... integral membrane proteins from the mitochondrial outer membrane, and of the 11 mostabundant integral proteins, 10 had a-helical transmem-brane segments. Of these 10 proteins, most had asingle ... trans- membrane segments that are assembled into the mito-chondrial outer membrane. Results and Discussion Integral membrane proteins in the mitochondrial outer membrane The protein proﬁle of mitochondrial ... (P). Proteins were then analyzed by immunoblotting afterSDS ⁄ PAGE using antisera against the matrix-located mtHsp70, the membrane protein porin and GFP. Integral proteins in the mitochondrial outer...

Báo cáo khoa học: Diversity of metallothioneins in the American oyster, Crassostrea virginica, revealed by transcriptomic and proteomic approaches potx

... report the results of a study, combining tran-scriptomic and proteomic approaches, designed to increaseour knowledge of the structure and function of oyster MTs in the American oyster, C. virginica, ... between the a- and b-domains of invertebrate and vertebratedomains would require an inversion within the MT gene of the a and b encoding segments, an event of which there isno obvious record in the genes. The ... MT. This theory of domainduplication is further supported by the widespread occur-rence of the ab- and ba-domain structures of manyinvertebrate and vertebrate MTs and their roles in zinchomeostasis...

Báo cáo khoa học: "Metabolism of isopentenyladenosine in the roots of Norway spruce seedlings exposed to nutritive stress" pdf

... I). Original articleMetabolism of isopentenyladenosine in the roots of Norway spruce seedlings exposed to nutritive stressK von SchwartzenbergM Bonnet-MasimbertP DoumasINRA, ... roots of the stressed seedlings. Results are discussed with regard to the levels of endogenous cytokinins measured in spruce affected by the novel type of forest decline.Picea ... Afterfeeding with tritiated isopentenyladenosine via the roots, the metabolism of cytokinins in the roots of stressed and control plants was compared. HPLC radioactivity profiles...

báo cáo khoa học: " Canada''''s implementation of the Paragraph 6 Decision: is it sustainable public policy?" ppsx

... agreement with the intent of the legislation but highly critical of the legis-lation in its current form. The barriers highlighted by civilsociety were consistent with those cited by the genericdrug ... 1999,14:115-1 26. BioMed CentralPage 1 of 9(page number not for citation purposes)Globalization and HealthOpen AccessResearchCanada's implementation of the Paragraph 6 Decision: is it sustainable ... use of this legislation. CAMR assumes that developing country governments have the requisite knowledge and human resource capacity to make use of the regime, which is not the case. The legislation...

Báo cáo khoa học: " Role of iron in anaemic critically ill patients: it’s time to investigate" pps

... stimulatesCommentary Role of iron in anaemic critically ill patients: it’s time to investigate!Michael Piagnerelli1and Jean-Louis Vincent21Resident, Department of Intensive Care, Erasme ... common problem in critically ill patients admitted to intensive care units. Many factorscan be involved in its development, including rapid alterations in iron metabolism. Maintenance of iron homeostasis ... decrease in the iron level in blood.Proinflammatory cytokines such as tumour necrosis factor-α,IL-1β and IL-6 induce the transcription and the translation of ferritin; modulate the binding affinity...

Báo cáo khoa học: "Etomidate, pharmacological adrenalectomy and the critically ill: a matter of vital importance" pps

... translates into a numberneeded to treat of five patients. The early advantage of relative haemodynamic stability at intubation, which itself isnot an important patient-centred outcome and can ... these patients are treated with cortico-steroids [9]. Other critically ill patients without septic shockmay also be at risk but the data are observational and weaker[8]. There can be a lag time ... for steroid replace-ment may be variable and is as yet undefined.It would therefore seem reasonable for ICU physicians tofollow the advice of Annane and avoid the use of etomidate[12]. This...

Báo cáo khoa học: " Adrenal function testing in patients with septic shock" doc

... laboratorial diagnosis of AF with norepinephrineremoval in patients with septic shock. Patients and methods Patients This prospective and noninterventional study was carried out in an ICU of a tertiary ... regarding Δmax249 ≤ 9 μg/dl was notinfluenced by serum albumin levels. These findings highlightthe importance of measuring the adrenal gland reserve (Δmax)Table 2 Adrenal function according ... predominance. Bacteremia wasdetected in 22 (21.6%) patients, and nosocomial infectionswere as frequent as community infections. All patients werereceiving norepinephrine when the corticotropin...

Báo cáo khoa học: "Blood glucose measurements in the critically ill: more than just a blood draw" doc

... Corstjens andcolleagues [1], yields glucose results dependent on hemato-Commentary Blood glucose measurements in the critically ill: more than just a blood drawFrank M Brunkhorst1and Hans G Wahl21Department ... While data about the beneficial effects ofnormoglycemia in critically ill patients are conflicting andinconsistent [2,3], there is no doubt about the importance ofaccurate glucose measurements ... Page 1 of 2(page number not for citation purposes)Available online http://ccforum.com/content/10/6/178Abstract A crucial determinant for the success of intensive insulin therapy in critically...

Báo cáo khoa học: "Kidney function assessment in the critically ill child: is it time to leave creatinine behind" pot

... is therefore the first report of non -creatinine- based methods to estimate renal function in critically ill pediatric patients withAKI. The rationale for assessing AKI markers in critically ill ... for longitudinal assessment of baselinerenal function. The accurate diagnosis of acute kidney injury(AKI) is especially problematic in critically ill patients in whomrenal function is in an ... analysis of the abilityof cystatin C and β2microglobulin to reflect creatinine clearance in pediatric patients with AKI. The aim of this commentary is to review the current state of AKI clinical...

Báo cáo y học: " Impact factor, H index, peer comparisons, and Retrovirology: is it time to individualize citation metrics?" ppsx

... exist. This was aperiod when if one wished to learn what was being pub-lished, one had to reach for the weekly/monthly periodi-cals (that often meandered through the postal servicesometimes, ... spotlights what IF in partdoes and does not convey. With that disclaimer, how is Retrovirology doing IF-wise as the journal enters its fourthyear? Employing the algorithm that IF derives from thenumber ... not for citation purposes)another way to quantify a scientist's quality and quantityof scholarly output [7,8]. This index attempts to combine and balance the effect of "quantity"...

Xem thêm