Báo cáo khoa học: "Cystatin C and beta2-microglobulin: markers of glomerular filtration in critically ill children" potx

Báo cáo khoa học: "Cystatin C and beta2-microglobulin: markers of glomerular filtration in critically ill children" potx

Báo cáo khoa học: "Cystatin C and beta2-microglobulin: markers of glomerular filtration in critically ill children" potx

... value and 95% confi- dence interval (CI) unless indicated otherwise. Inverses of Cr, cystatin C, and B2M were correlated with CrC and with Schwartz. We used the inverses of creatinine, cystatin C, ... for creatinine). Conclusion Serum cystatin C and B2M were confirmed as easy and useful markers, better than serum creatinine, to detect acute kidney injury in critically...
Ngày tải lên : 13/08/2014, 03:21
  • 7
  • 296
  • 0
Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

Tài liệu Báo cáo khoa học: Complex transcriptional and translational regulation of iPLA2c resulting in multiple gene products containing dual competing sites for mitochondrial or peroxisomal localization docx

... ACTGCCATGGTGGCCTTCACTTTTGGTCCATTTAC 85 85F TGGAAAGCTTGCCACATCAGTCTACAAAG 85R TGCTCCATGGTGGCATCCCAATATGTAAACCA 83 83F GAACCAAGCTTGAAGCACATTCTTGCAGTAAGCA 83R CAAAACATGTTGGCTACGGGACATACAAATGTTCA 80 ... 5¢-TCAAGGTACCATGATTTCCTGAAGG-3¢;P2, 5¢-CTGAAGATCTAGCCTTTACTTTCA-3¢;P3,5¢-GC TAGGTACCAATACAGTAATATATG-3¢;P4,5¢-TGC TAGATCTCCACCCACTCA-3¢;P5,5¢-TTATGGTACC TGAAAGGGAATAGCGGC-3¢;P6,5¢-GGCTGGTAC CCTTGC...
Ngày tải lên : 19/02/2014, 16:20
  • 16
  • 438
  • 0
báo cáo khoa học: "HGF/c-Met related activation of b-catenin in hepatoblastoma" pps

báo cáo khoa học: "HGF/c-Met related activation of b-catenin in hepatoblastoma" pps

... allowing its accumulation in the nucleus where it acts as a TCF/LEF transcription cofactor. Thus, HGF /c- Met related activa- tion of b-catenin occurs independent of the canonical Wnt/b-catenin pathway ... negative for staining with an antibody to Y654- b-catenin. (b) Diffuse cytoplasmic staining of Y654- b-catenin. (c) Nuclear and cytoplasmic staining of Y654- b-catenin in hepa...
Ngày tải lên : 10/08/2014, 10:21
  • 10
  • 201
  • 0
Báo cáo khoa học: "Early percutaneous dilatational tracheostomy leads to improved outcomes in critically ill medical patients as compared to delayed tracheostomy" doc

Báo cáo khoa học: "Early percutaneous dilatational tracheostomy leads to improved outcomes in critically ill medical patients as compared to delayed tracheostomy" doc

... bronchoscopic surveillance. Clinical circumstances determined whether patients who were randomized to receive a delayed tracheostomy actually received one. Outcomes: Time in the intensive care ... Critical Care Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania, USA 2 Professor and Chair, Department of Critical Care Medicine, University of Pittsb...
Ngày tải lên : 12/08/2014, 22:22
  • 2
  • 285
  • 0
Báo cáo khoa học: "Towards a feasible algorithm for tight glycaemic control in critically ill patients: a systematic review of the literature" pdf

Báo cáo khoa học: "Towards a feasible algorithm for tight glycaemic control in critically ill patients: a systematic review of the literature" pdf

... results in terms of glycaemic control and reported low frequencies of hypoglycaemic episodes. Introduction Evidence is increasing that tight glycaemic control reduces morbidity and mortality in critically ... glycaemic control in only two- thirds of ICU patients. Continuous insulin infusion Most study protocols used continuous intravenous insulin infu- sion combined with int...
Ngày tải lên : 12/08/2014, 23:21
  • 7
  • 326
  • 0
Báo cáo khoa học: Conformational stability and multistate unfolding of poly(A)-specific ribonuclease docx

Báo cáo khoa học: Conformational stability and multistate unfolding of poly(A)-specific ribonuclease docx

... non- native secondary structures are induced by low concen- trations of urea in the intrinsic disordered C- terminal domain, which result in an increase in the CD signal. In general, the structural transition ... with GdnHCl concentration, suggesting that there may be more than one intermediate accumulated between 0.5 and 3 m GdnHCl. The intrinsic Trp fluorescence and extrinsic...
Ngày tải lên : 23/03/2014, 04:21
  • 12
  • 433
  • 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx

... C- terminal cysteines in the t peptide and N-terminal cysteines in the PRAD (CC-Q N ), or vice versa between N-terminal cysteines of the t peptide and C- terminal cysteines in the PRAD (Q N -CC). ... Q N protein possessing two adjacent cysteines C7 0 and C7 1 upstream of the PRAD (CC-Q N ), and with a Q N mutant in which the original cysteines were mutated to serines...
Ngày tải lên : 30/03/2014, 13:20
  • 15
  • 333
  • 0
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

... insecticidal toxin (SMC) in E. coli The SMC gene amplified by PCR using the vector sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense (VA) (5¢-CCGCTCG AGCTTCATAGAAATAGTCGCCTC-3¢)primerswas cloned ... Ni/nitrilotriacetic acid affinity column combined with the gel-filtration column (Fig. 2B, W). The insecticidal activities (MPD, ng per insect) of the recombinant SMC agai...
Ngày tải lên : 30/03/2014, 13:20
  • 6
  • 456
  • 0
Báo cáo khoa học: "Cystatin C: unsuited to use as a marker of kidney function in the intensive care unit" pot

Báo cáo khoa học: "Cystatin C: unsuited to use as a marker of kidney function in the intensive care unit" pot

... are warranted. Competing interests The author(s) declare that they have no competing interests. References 1. Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin C as a marker of acute ... rate in thyroid dys- function? Clin Chem 2003, 49:1558-1559. 4. Bökenkamp A, Domanetzki M, Zinck R, Schumann G, Byrd D, Brodehl J: Cystatin C serum concentrations underestimat...
Ngày tải lên : 12/08/2014, 22:21
  • 2
  • 297
  • 0