Báo cáo khoa học: "Intracranial pressure monitoring in inten

Báo cáo khoa học: "Intracranial pressure monitoring in intensive care: clinical advantages of a computerized system over manual recording" potx

... of 6 (page number not for citation purposes) Vol 11 No 1 Research Intracranial pressure monitoring in intensive care: clinical advantages of a computerized system over manual recording Elisa ... patient's next of kin was informed, and written consent was obtained with the understanding that routine clinical and monitoring data were to be collected, store...

Ngày tải lên : 13/08/2014, 03:20

6
311
0

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... Puriﬁcation and characterization of a transmembrane domain-deleted form of lecithin retinol acyltransferase. Biochemistry 42, 6090–6098. 45 Muniz A, Vi...

Ngày tải lên : 14/02/2014, 14:20

14
753
0

báo cáo khoa học: " Implementing quality indicators in intensive care units: exploring barriers to and facilitators of behaviour change" pot

... additional training, including handbooks and instructions on how to collect data. Healthcare professionals and managers between 40 and 49 years old and working in academic or teaching hospitals ... development of indicators is emerging and examples of sets of indicators for quality of hospital care are available [1,2]. Although quality indicators are applied as a tool to guide the...

Ngày tải lên : 10/08/2014, 10:23

8
273
0

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... X-linked agammaglobulin- emia. A clinical and molecular analysis. Medicine (Baltimore) 75, 287–299. 27 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini ... Hussain 1,2, *, Liang Yu 1,3, *, Rani Faryal 1,2 , Dara K. Mohammad 1 , Abdalla J. Mohamed 1,4 and C. I. Edvard Smith 1 1 Clinical Research Center, Department of Laboratory Medicine, Karoli...

Ngày tải lên : 14/02/2014, 18:20

10
926
0

Tài liệu Báo cáo khoa học: Integral membrane proteins in the mitochondrial outer membrane of Saccharomyces cerevisiae docx

... compilation ª 2006 FEBS and alkali extraction might not always be a reliable indicator of whether a protein is integral in the outer membrane [17,20–22]. As a distinct means to separate integral and ... Osanai K, Takahashi K, Nakamura K, Takahashi M, Ishigaki M, Sakuma T, Toga H, Suzuki T & Voelker DR (2005) Expression and characterization of Rab38, a new member of the Rab...

Ngày tải lên : 19/02/2014, 07:20

9
554
0

Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

... some of which are (a) nasals in Tamil (Shanmugam, 1972) and Malayalam (Shanmugam, 1972; Ladefoged and Maddieson, 1996), (b) laterals in Albanian (Lade- foged and Maddieson, 1996), and (c) stops in ... inventories: A complex network ap- proach. In COLING-08, pages 601–608. J. R. Quinlan. 1993. C4.5: Programs for Machine Learning. Morgan Kaufmann. S. V. Shanmugam. 1972. Dental and a...

Ngày tải lên : 22/02/2014, 02:20

9
703
1

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... the N-terminal domain, the comparable overall trypto- phan exposure in the mutants compared with the wild-type protein indicates that the structure of the N-terminal domain is maintained, at least in ... at a molar ratio of 0.5 : 1.0 Hsp25 : insulin (Fig. 7), with all mutants showing comparable suppression of insulin precipitation at this ratio. All of the glutamic acid residue...

Ngày tải lên : 07/03/2014, 04:20

14
417
0

Báo cáo khoa học: Polysaccharide binding sites in hyaluronate lyase – crystal structures of native phage–encoded hyaluronate lyase and its complexes with ascorbic acid and lactose docx

... vitro activity assay for HylP2 was performed using HA as substrate and ascorbic acid as an inhibitor. The activity of the enzyme was determined by measuring its ability to breakdown HA to unsaturated ... lactose Parul Mishra 1, *, R. Prem Kumar 2, *, Abdul S. Ethayathulla 2 , Nagendra Singh 2 , Sujata Sharma 2 , Markus Perbandt 3 , Christian Betzel 3 , Punit Kaur 2 , Alagiri Srinivasan 2 ,...

Ngày tải lên : 23/03/2014, 04:21

11
517
0

Báo cáo khoa học: D-Amino acids in the brain: the biochemistry of brain serine racemase potx

... using a human hippocampal cDNA library, a different PDZ domain- containing protein was found to interact with serine racemase, also requiring the C-terminal binding motif [30]. Protein interacting ... The ﬁnding of serine racemase interacting with the PDZ6 domain of GRIP and being activated was the ﬁrst report on cellular interaction partners of serine racemase and it raised sever...

Ngày tải lên : 30/03/2014, 04:20

8
402
0

Báo cáo khoa học: "Wood density traits in Norway spruce understorey: effects of growth rate and birch shelterwood densit" ppsx

... thus individual trees were used as observations in all statistical analyses. The average of 8.5 annual rings with an average cambial age of 25 years was included in the ... separately in order to examine radial variations, and the coefficient of variation (CV) for density and ring width was calculated for each tree. An attempt was mad...

Ngày tải lên : 08/08/2014, 14:21

13
245
0