Báo cáo khoa học: "Could dopamine be a silent killer" ppsx
... the case with most observational pharmacoepidemiology studies, there are a number of limitations that deserve consideration. Being observational in nature, this study cannot prove a cause and ... Critical Care 2006, 11: 302 (DOI 101186/cc5146) Azarov, Milbrandt, and Pinsky with increased mortality in shock and called for prospective randomized trials of dopamine and other catechol...
Ngày tải lên: 13/08/2014, 03:20
... proportionnal to a* j3 + a( 3 * k. The ESS (Evolutionnary Stable Strategy), defined as a set of values of a* and !* such that no mutant with a different strategy can be selected, ... ». A. In the absence of male and female individuals in the population The fitness of a hermaphroditic organism with a strategy (a, p, s) in a populatio...
Ngày tải lên: 09/08/2014, 22:23
... particularly if it is one that may not be classically termed a medical ‘success’; however, death should not be seen as a failure, but rather as a natural and necessary process. How often do we hear ... I outline above, these are ethically and morally identical concepts; withdrawal of therapy should be permitted and may even be preferable to withholding therapy. In all cases the...
Ngày tải lên: 12/08/2014, 22:21
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx
... expec- tations to motion sickness symptoms and gastric activity. J Psychosom Res 2004, 56:721-726. 10. Sugita N, Yoshizawa M, Abe K, Tanaka A, Watanabe T, Chiba S, Yambe T, Nitta S: Evaluation of adaptation ... drafting of the study and the final preparations before submission. TF Participated in the design and preparations of the study. TF also partici- pated in the analysis and drafting of...
Ngày tải lên: 19/06/2014, 08:20
Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx
... E, Zimmermann M, Cattabeni F, Padovani A & Di LM (2002) [alpha]-Secretase ADAM10 as well as [alpha]APPs is reduced in platelets and CSF of Alzhei- mer disease patients. Mol Med 8, 67–74. 89 Colciaghi ... an interaction partner for ADAM10 that enhances a- sec- retase shedding of APP, probably by regulating matu- ration of the prodomain of ADAM10 [22]. The catalytical domain of ADAM10 co...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... the American Can- cer Society and by NIH grant number R01CA140522 from the National Cancer Institute (to MSC). We thank Venkat Dharmarajan for a critical reading of this manuscript. We would also ... the ALL1 gene. Cancer Res 56, 1766–1769. 12 Nakamura T, Mori T, Tada S, Krajewski W, Rozovskaia T, Wassell R, Dubois G, Mazo A, Croce CM & Canaani E (2002) ALL-1 is a histone methyl- tra...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... there have been reports that there is protease contamination of some commercially available bacitracin preparations [31], we were loathe to fractionate the material to ensure that there was no ... fragment, and BiP Ala324–Leu653 as a SacI–XhoI fragment. Mature human ERp27 (Glu26–Leu273) was generated by PCR from IMAGE clone 5207225 as an NdeI–BamHI fragment. Mature E. coli DsbA (Ala20–Leu20...
Ngày tải lên: 16/02/2014, 14:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 281–289. 20 Parthasarathy S, Ravindra G, Balaram H, Balaram ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawah...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) Sense ARS with PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc Antisense ... overall CMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... H, Ikeda K, Yasuda K, Kato A, Martin OR & Fan J-Q (2000) In vitro inhibition and intracellular enhancement of lysosomal a- galactosidase A activity in Fabry lymphoblasts by 1-deoxygalactono- jirimycin ... 13813–13818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynojirimycin as a pharmacological chaperone for Gaucher...
Ngày tải lên: 18/02/2014, 16:20