Báo cáo khoa học: " Bench-to-bedside review: Endotoxin tolerance as a model of leukocyte reprogramming in sepsis" pot

... Minoda Y, Takaki H, Sanada T, Kobayashi T, Aburatani H, Yamanashi Y, Yoshimura A: FLN29, a novel interferon- and LPS-inducible gene acting as a negative regulator of toll-like receptor signaling. ... Shinohara H, Inoue A, Toyama-Sorimachi N, Nagai Y, Yasuda T, Suzuki H, Horai R, Iwakura Y, Yamamoto T, Karasuyama H, et al.: Dok-1 and Dok-2 are negative regulators of lipopolysaccha-...

Ngày tải lên: 13/08/2014, 03:20

... Rocheleau CA: Increasing family consent for organ donation: findings and challenges. Prog Transplant 2001, 11:194-200. 28. Siminoff LA, Arnold RM, Caplan AL: Health care professional attitudes toward ... donation in brain dead pediatric trauma victims. J Trauma 2001, 51:329-331. 30. Linyear AS, Tartaglia A: Family communication coordination: a program to increase organ donation. J Trans...

Ngày tải lên: 12/08/2014, 20:20

... this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar media lacking added phenylalanine and tyrosine reports on the chorismate mutase activity ... dehydrogenase protein com- plexes were replaced by genes encoding monofunctional versions of the dehydratase and the dehydrogenase. The growth of this strain on minimal media lacking...

Ngày tải lên: 19/02/2014, 12:20

... muscle remodelling in skeletal muscle. Abbreviations AAV2/1, adeno-associated virus 2/1; Ankrd2, ankyrin repeat domain-containing protein 2; CARP, cardiac ankyrin repeat protein; DAPI, 4¢,6-diamidino-2-phenylindole; ... TGTTGTCGTGTGCTGGGATT MLC-f Myosin light chain, fast BC055869 396mMLCfast.F: TGGAGGAGCTGCTTACCACG 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTG...

Ngày tải lên: 07/03/2014, 03:20

... tyro- sine kinase activates several signalling pathways, includ- ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription (JAK-STAT) pathway, ... signal-regu- lated kinase kinase 1 ⁄ 2 kinases: mechanism of action in vivo, pharmacokinetic ⁄ pharmacodynamic relationship, and potential for combination in preclinical models. Mol...

Ngày tải lên: 16/03/2014, 00:20

... Iron Score. Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using haz- ard regression analysis. Survival time was measured from the date of transplant ... in early survival was primarily due to an increased number of treatment related deaths (p = 0.018) (Figure 2B). Meanwhile, iron overload was not associated with a significant...

Ngày tải lên: 10/08/2014, 22:20

... conscious if awake or capable of following simple commands at least once. Statistical analysis Continuous data are presented as means and SD, and nonpar- ametric data as medians and interquartile range. ... purpose. Neuron-specific enolase (NSE) is a known marker of ischemic brain damage and has already been evaluated in traumatic brain injury [10], stroke [11] and anoxic encephal...

Ngày tải lên: 13/08/2014, 03:20

... will aid in assessing the translational potential of ideas that are still in the percolation phase. The NIH intramural program is an ideal test site for such new translational research approaches, ... program is often close to impermeable. In contrast, universities and many research institutions contain a semi-permeable barrier that allows academic investigators to work in both ar...

Ngày tải lên: 18/06/2014, 19:20

... interests MRE-B is a translational researcher who has participated in many laboratory and clinical research studies, as well as several successful biotechnology company start-ups, both privately and in his ... new thinking along these lines and could serve as a template for commercializ ation efforts in the percubator [12,13]. And as a practical matter, designat- ing percu...

Ngày tải lên: 20/06/2014, 03:20

... 10 minutes) and was measured using a commercially available pH meter (Model 3510, Jenway, Essex, UK). Statistical analysis Data are expressed as mean ± standard deviation (SD) or as median (interquartile ... has evaluated the association of EBC pH with functional and clinical parameters that are relevant to clinical practice in a large cohort of patients with COPD. The aim of...

Ngày tải lên: 12/08/2014, 13:22