Báo cáo y học: " The Infectious Diseases BioBank at King''''''''s College London: archiving samples from patients infected with HIV to facilitate translational research" pps
Báo cáo y học: " The Infectious Diseases BioBank at King''''s College London: archiving samples from patients infected with HIV to facilitate translational research" pps
... citation purposes) Retrovirology Open Access Commentary The Infectious Diseases BioBank at King's College London: archiving samples from patients infected with HIV to facilitate translational ... virtually any type of biomedical research. The HIV component of the BioBank contains samples from over 400 donations from 138 HIV+ patients. Thu...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: "Characteristics of repair tissue in second-look and third-look biopsies from patients treated with engineered cartilage: relationship to symptomatology and time after implantation" ppsx
... implantation rather than within 18 months of implantation. Moreover, we noted a corre- lation between the symptomatology of patients and the nature of the reparative tissue. Asymptomatic patients ... obtained from asymptomatic patients onlyHistological and immunohistochemical analysis data for biopsies obtained from asymptomatic patients only (n = 47). The biopsies were...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx
... reading frame with Pfu DNA polymerase (Stratagene) using a standard protocol. The following primers were used: sense (1), 5¢-CG GGATCC ACCATGCATCATCATCATCATCATCATCATGATA TGGAAATTGATGACCCTATG-3¢ (BamHI ... primer: 5¢-CG GGATCCACCATGCATCATCATCATCATCAT CATCATCTTGACCAATGGATTGAGCATTTG-3¢ (BamHI site underlined, 8 · His-tag bold) and antisense: 5¢-CG GAATTCTTACTGATTTATATTTGTATTGGT CAG-3¢ (EcoRI...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx
... to a catalytic site, but the position is at the c phosphate of ATP, and does not interfere with ADP binding. The other is that P i binds to a site o ther than any of the catalytic sites. In the ... is highly likely that the presence of P i at a catalytic site suppresses the formation of the MgADP-inhibited state. The recently reported crystal structure of mitochond...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo y học: "The association of psychological stress and health related quality of life among patients with stroke and hypertension in Gaza Strip" pps
... level of education were significantly asso- ciated with worse scores of quality of life in primary care patients with obesity [31]. Limitations of the study The duration of treatment of hypertension ... was at least 1 year at the time patients were included into the study. No more medical details on the course of the dis- ease in the previous year, on the type of b...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "The Factors Influencing Depression Endpoints Research (FINDER) study: final results of Italian patients with depressio" docx
... 9:33 http://www.annals-general-psychiatry.com/content/9/1/33 Page 2 of 9 Another result of our study indica tes that a higher severity of somatic and painful symptoms at base line, as evaluated by patients, was associated with ... depressed patient, as they can negatively influence HRQoL. Moreover depressed patients with higher levels of somatic an d painful symp- toms may respond le...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
... specificity for antigen. Nat Immunol 2002, 3:756-763. 9. Kawahata K, Misaki Y, Yamauchi M, Tsunekawa S, Setoguchi K, Miyazaki J, Yamamoto K: Generation of CD4 + CD25 + regulatory T cells from autoreactive ... critically involved in the control of immune responses against pathogens [25,26], their physiological function is not just to prevent autoimmunity but also to control the ext...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "The reported thoracic injuries in Homer’s Iliad" potx
... not only to the method used by the perpetrator to injure his/her victim or the area where the injury occurred but also to ot her factors, such a s the place of origin of the victim and the perpetrator, ... called Nestor to lead the doctor a way from the batt lefiel d to the ships (b. 11, v. 511-513) [1]. Even in the heat of the battle Idomeneus does not hes...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: " The cross-sectional GRAS sample: A comprehensive phenotypical data collection of schizophrenic patients" pptx
... Psychiatry and Psychotherapy, Ecumenical Hospital Hainich, Germany. 3 Hospital of Psychiatry and Psychotherapy, Center for Integrative Psychiatry, Kiel, Germany. 4 Karl-Jaspers-Hospital, Psychiatric ... Wilhelmshaven, Germany. 9 Vitos Hospital of Forensic Psychiatry Eltville, Eltville, Germany. 10 Vitos Hospital of Psychiatry and Psychotherapy Merxhausen, Kassel, Germany. 11 Department of Psy...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: " The development of a knowledge test of depression and its treatment for patients suffering from non-psychotic depression: a psychometric assessment" ppt
... con- sistency of 0.13, and explains 5.4% of the observed vari- ance. This component refers to the patients& apos; ability to recognize the normal from the abnormal mood states and what is expected from them ... and illicit drug abuse, patients suffering from psychotic symptoms, and patients suffering from all degrees of mental handicap, were excluded from the stud...
Ngày tải lên: 11/08/2014, 17:20