Báo cáo khoa học: "Levels of protein C and activated protein C: what do they mean" doc

... GGT G-3¢; HCV-1bCore+1/S sense, 5¢-ATC CGG GGT CTCCCATG GCAATG AGG GCC TGG GGT G-3¢; HCV-1a Core+1/Santisense, 5¢-AT CCG GGT CTCGGTACC TTA TCACGC CGT C TT CCA GAA C- 3¢; and HCV-1b Core+1/Santisense, ... Bre´chot) [69] and thefollowing primers: sense, 5¢-CAT GCC ATG GCA CCA ACCGCC GCC CAC A-3¢; and antisense, 5¢-CCCAAG CTTGGG GGG CGC CGA CAA GC-3¢ (underlined sequencesindicate NcoI and HindIII ... carbonchemical shifts and random coil values as afunction of sequence number. (C) SSP of HCV-1b Core+1/S. Carbon chemical shiftswere used to calculate the residue-speci c SSP scores of HCV-1b Core+1/S...

... photosynthetic growth, theinsertion of PufX in the core LH1–RC complex, the stability of the dimers and the kinetics of flash-induced reduction of cytochrome b561 of the cytochrome bc1complex. ... hrlich,S., Chen, J. & Loach, P.A. (2001) Role of the core region of thePufX protein in inhibition of reconstitution of the core light-har-vesting complexes of Rhodobacter sphaeroides and Rhodobactercapsulatus. ... bacteriochlorophyll; cyt bc1, cytochrome bc1complex; ICM, intracytoplasmic membranes; LH, light-harvestingcomplex; PMC, photosynthetic membrane complex; QA,QB, primary/secondary electron...

... Release of mitochon-drial cytochrome c triggers assembly of a caspase-9-activating complex and subsequent activation of thedownstream caspase cascade. These pathways are notmutually exclusive and ... attached to theculture dish. Since the detachment of cells and condensation of chromatin also occurs during mitosis[28], we tested the impact of the pan-caspase inhibitorZ-VAD-FMK on cell ... Associa-tion of mammalian cell death with a speci c endonu-cleolytic degradation of DNA. Nature 252, 754–755.42 Bain J, McLauchlan H, Elliott M & Cohen P (2003)The specificities of protein...

... Diabetes, Metabolism and Endocrinology, Lund University, Sweden2 Department of Molecular Biophysics, Lund University, Sweden3 Department of Clinical Sciences, Division of Infection Medicine, Lund University, ... adipocytes,stimulation of lipolysis by catecholamines results inactivation of adenylate cyclase, leading to elevatedKeywordscholesterol ester hydrolase; electronmicroscopy; fluorescence spectroscopy;phospholipid ... Furthmayr H (1987) Electron microscopy and other physical methods for the characterization of extracellular matrix components: laminin, fibronectin,collagen IV, collagen VI, and proteoglycans. MethodsEnzymol...

... enhanced thebinding of InsP6to PhyAsr (Table 1). Given the absence of structural changes as a function of ionic strength and ligand binding, the effect of ionic strength on catalyticactivity ... oxidation.DiscussionEffect of ionic strength on PhyAsr catalysis and P-loop structureChanges in ionic have been observed to affect the cata-lytic efficiency of some PTPs. For example, at high ionicstrength ... a consequence of this stericconstraint, the P-loop of Cdc25B also undergoes a largeconformational change upon oxidation of the catalyticcysteine (Fig. 3B).Sensitivity and reversibility of...

... (1989)Dephosphorylation of cofilin accompanies heat shock-inducednuclear accumulation of cofilin. J. Biol. Chem. 264, 16143–16148.Ó FEBS 2003 Actin and small heat shock protein (Eur. J. Biochem. 270) 901nucleus ... excess heat capacity curve of G-actin can be fitted intotwo independent intermediate steps with Tm of 52 and 57 C, respectively. Therefore, the scheme of actin unfoldingis more complex and can ... for estimation of nativity of actin preparations. Corrected spectra of actinfluorescence excited at 297 nm were recorded in the range300–400 nm on the Hitachi F-3000 fluorescence spectro-photometer....

... part of the figure shows an alignment of the N-terminalMUC5AC sequences of M-MUC5AC-CH-long and M-MUC5AC-CH-short and the corresponding sequences of human, rat and mouseMUC5AC. Long, M-MUC5AC-CH ... dimeric M-MUC5AC-CH; Monomer, monomericM-MUC5AC-CH; M-5AC-CH, reduced M-MUC5AC-CH; C2 -H, C- ter-minal cleavage fragment. The weak band corresponding to the C2 -H cleavage fragment is indicated ... the C- terminal cysteine-rich domain of human MUC2. Celllysates from CHO-K1 cells and CHO-K1 cells stably expressingeither M-MUC5AC-CH-long or the corresponding C- terminal cyste-ine-rich domain...

... D221KCLAP_1:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT 800 CLAP_2:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT ... CLAP_1:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC 200 CLAP_2:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC ... S155CLAP_1:CAAATTATGAAGCTCACAATGGTGTTCTGCATCTCCTTGAAGATGTGATTGTCTCTATACCAGCACGACATGGAACAGTGATTCACCAGCTGAGAAGATG 600 CLAP_2:CAAATTATGAAGCTCACAATGGTGTTCTGCATCTCCTTGAAGATGTGATTGTCTCTATACCAGCACGACATGGAACAGTGATTCACCAGCTGAGAAGATG...