Báo cáo khoa học: "A Dopexamine and norepinephrine versus epinephrine on gastric perfusion in patients with septic shock: a randomized study" pdf

Báo cáo khoa học: "A Dopexamine and norepinephrine versus epinephrine on gastric perfusion in patients with septic shock: a randomized study" pdf

Báo cáo khoa học: "A Dopexamine and norepinephrine versus epinephrine on gastric perfusion in patients with septic shock: a randomized study" pdf

... vascular effects induced by the combination of dopexamine and norepinephrine. Epinephrine also induced a significant increase in arterial lactate, as has already been shown in patients with septic ... of dopexamine and norepinephrine. The ratio between GMBF and cardiac output decreased during epinephrine infusion, whereas it did not change during dopexamine norepi...

Ngày tải lên: 12/08/2014, 23:21

8 314 0
Báo cáo khoa học: "Effect of mode of hydrocortisone administration on glycemic control in patients with septic shock: a prospective randomized trial" pptx

Báo cáo khoa học: "Effect of mode of hydrocortisone administration on glycemic control in patients with septic shock: a prospective randomized trial" pptx

... In addition, patients had to receive norepinephrine at any dose to maintain mean arterial blood pressure above 65 mm Hg. Patients under 18 years of age, patients with pre-existing diabetes, and ... gastrointestinal primary disease (gastrointestinal perforation or acute pancreatitis) and in these patients the enteral feeding could not always be increased according to Table...

Ngày tải lên: 13/08/2014, 03:20

9 221 0
báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps

báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps

... Leininger JD, Overman SS: Measuring functional outcomes in chronic disease: a comparison of traditional scales and a self-administered health status questionnaire in patients with rheumatoid arthritis. ... belongs to the domain body functions. The WHODAS-II contains an item that was linked to the general tasks and demands category (D2302) from chapter 2, general tasks and de...

Ngày tải lên: 12/08/2014, 00:20

13 385 0
Báo cáo y học: "The effects of long-acting bronchodilators on total mortality in patients with stable chronic obstructive pulmonary disease" pdf

Báo cáo y học: "The effects of long-acting bronchodilators on total mortality in patients with stable chronic obstructive pulmonary disease" pdf

... that 1) inhaled corticosteroids (ICS) in combination with a long-acting bronchodilator (LABA) were associated with a ~20% reduction in total mortality; whereas LABAs or long-acting anticholinergics ... GJ, Castro-Rodriguez JA, Plaza V: Safety and efficacy of combined long-acting beta-agonists and inhaled corticosteroids vs long-acting beta-agonists monotherapy for stable COP...

Ngày tải lên: 12/08/2014, 11:21

13 438 0
Báo cáo y học: "Phenotype changes and impaired function of dendritic cell subsets in patients with sepsis: a prospective observational analysi" ppsx

Báo cáo y học: "Phenotype changes and impaired function of dendritic cell subsets in patients with sepsis: a prospective observational analysi" ppsx

... expression on circulating monocyte and dendritic cell subsets in patients with sepsis at baseline and at day 28 compared with healthy controls. Monocyte and dendritic cell subsets were stained and ... and gated as described in Figure 1. (a) The HLA-DR expression in each monocyte subset was quantified using a standardized assay as described in Materials and metho...

Ngày tải lên: 13/08/2014, 18:22

12 237 0
Báo cáo hóa học: " Trichloroethylene exposure and somatic mutations of the VHL gene in patients with Renal Cell Carcinoma" potx

Báo cáo hóa học: " Trichloroethylene exposure and somatic mutations of the VHL gene in patients with Renal Cell Carcinoma" potx

... germline and somatic mutations of this gene in VHL patients and sporadic RCC. Today, more than 400 germline mutations have been reported in VHL patients and about 300 somatic mutations in sporadic RCC ... cell carcinomas have a common carcinogenic pathway and that at least one gene should be altered in both forms. This has been confirmed with the cloning of the VHL gen...

Ngày tải lên: 20/06/2014, 00:20

7 442 0
Báo cáo y học: "Reduced number and impaired function of circulating progenitor cells in patients with systemic lupus erythematosus" pot

Báo cáo y học: "Reduced number and impaired function of circulating progenitor cells in patients with systemic lupus erythematosus" pot

... NIH, USA) and the caspase 8L:caspase 8a+ b ratio was calculated. Plasma levels of CRP and TNF-α Plasma samples were obtained from 14 patients and 10 con- trols by centrifugation of heparinized ... of patients and par- ticipated in design and drafting of the manuscript. MH participated in the design and coordination of the study and helped to draft the manuscript. All aut...

Ngày tải lên: 09/08/2014, 10:20

10 449 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan ... fw, forward; rev, reverse. Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD r...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx

Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx

... attack, emphasizing that the ‘sugar tongs’ participates in multivalent binding of polysaccharide substrates. Abbreviations AMY1 and AMY2, barley a- amylases 1 and 2; BASI, barley a- amylase ⁄ subtilisin inhibitor; ... whereas AMY1 Y380M and S378P maintained a DMA of 2.0 and 2.2, respectively. Binding of b-cyclodextrin to ‘sugar tongs’ mutants measured by surface plasmon resonanc...

Ngày tải lên: 23/03/2014, 07:20

13 385 0
Báo cáo khoa học: "Leaf area and tree increment dynamics on a fertile mixed-conifer site in southern Finland" doc

Báo cáo khoa học: "Leaf area and tree increment dynamics on a fertile mixed-conifer site in southern Finland" doc

... was measured using linear regression equations. For Scots pine, 5-year height increment (HI) was estimated using tree basal area (BA), and sapwood area at crown base (SACB) ... than 6 cm. All pine stands had vig- orous Norway spruce undergrowth. The pine overstory was even-aged (within-stand variation: 8 years) and even-sized (within-stand vari...

Ngày tải lên: 08/08/2014, 14:21

11 203 0
w