Báo cáo khoa học: " A Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts" ppt

Báo cáo khoa học: " A Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts" ppt

Báo cáo khoa học: " A Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts" ppt

... hospitals because of the complexity of analysis, unfamiliarity among cli- nicians and managers and difficulty in translating to clinical practice. The E-O chart offers a rapid and qualitative plot. ... 1 Research Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts Jerom...

Ngày tải lên: 12/08/2014, 23:21

9 305 0
Báo cáo khoa học: "Intracranial pressure monitoring in intensive care: clinical advantages of a computerized system over manual recording" potx

Báo cáo khoa học: "Intracranial pressure monitoring in intensive care: clinical advantages of a computerized system over manual recording" potx

... to the acquisition, analysis, and interpretation of data and helped to draft the manuscript. LG and SL made substantial contributions to the acquisition, analysis, and interpretation of data. AC ... properly capture ICP increases and to adequately rank the severity of ICP, comparisons with the digital tracing were made and the digital tracing was analyzed in...

Ngày tải lên: 13/08/2014, 03:20

6 311 0
Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

Báo cáo khoa học: "A Key advances in critical care in the out-of-hospital setting: the evolving role of laypersons and technology" docx

... http://ccforum.com/content/10/1/119 Abstract During the past decade, critical care in the out -of- hospital setting has transcended the original emphasis on on-scene advanced life support interventions by doctors, paramedics, and ... espoused the concept that a gram of good prehospital care can save a kilogram of in- hospital ICU care . In the case of automated...

Ngày tải lên: 12/08/2014, 23:21

3 281 0
Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

Báo cáo khoa học: A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii pdf

... serine protease inhibitor – a variant of PSKP-1 was prepared with Leu, Pro and Gly at P 6 ,P 5 and P 4 , respectively, and with Lys at P 1 (Fig. 2). The new variant, PSKP-1 K has a similar expression level ... sauvagii Kazal protein 1 (PSKP-1). After an initial search with BLAST [54], alignment to PSKP-1 was optimized manually. 1HPT and 2OVO are two examples of...

Ngày tải lên: 30/03/2014, 13:20

10 456 0
báo cáo khoa học: " Implementing quality indicators in intensive care units: exploring barriers to and facilitators of behaviour change" pot

báo cáo khoa học: " Implementing quality indicators in intensive care units: exploring barriers to and facilitators of behaviour change" pot

... clinical practice. Competing interests The authors declare that they have no competing interests. Authors' contributions All authors participated in manuscript preparation, and read and approved ... healthcare professionals and managers are familiar with using quality indicators to improve care, and that they have positive attitudes towards the implementation of quali...

Ngày tải lên: 10/08/2014, 10:23

8 273 0
Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf

Báo cáo khoa học: Examining multiprotein signaling complexes from all angles The use of complementary techniques to characterize complex formation at the adapter protein, linker for activation of T cells pdf

... signaling complexes form at the cytoplasmic domain of transmembrane receptors, and at modular enzymes and nonenzymatic adapter proteins. Such complexes are vital for the activation and propagation of ... 2005) doi:10.1111/j.1742-4658.2005.04972.x Dynamic protein–protein interactions are involved in most physiological processes and, in particular, for the formation of mu...

Ngày tải lên: 23/03/2014, 15:21

10 458 0
báo cáo khoa học: " Evidence-informed health policy 3 – Interviews with the directors of organizations that support the use of research evidence" pps

báo cáo khoa học: " Evidence-informed health policy 3 – Interviews with the directors of organizations that support the use of research evidence" pps

... publication. Authors' contributions JL participated in the design of the study, participated in analyzing the qualitative data, and drafted the article and the report in which it is based. AO conceived ... the data collection and the analysis of the qualitative data, and contributed to drafting the article. EP contributed to data collection. All author...

Ngày tải lên: 11/08/2014, 16:21

10 267 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx

... view of (A) , showing only the data obtained in the absence of Du.(C)Theratioof the best-fitting functions and of the data points of wild-type over mutant are plotted for data in the presence (d)andabsence(m)ofDu. 1988 ... substitution with a kanamycin resistance cassette. Therefore, the resulting strain carried the deletion of the chromosomal atp2 operon a...

Ngày tải lên: 21/02/2014, 03:20

9 580 0
Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx

Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx

... recognition of the need for explicit characterizations of the properties that relate and distinguish similar grammar formalisms. The paper proposes a series of changes in the for- malism of Generalized ... genuine gain in expressiveness for the formalism. Other devices, such as Feature Instantiation Principles and Linear Precedence Statements can be regarded a...

Ngày tải lên: 22/02/2014, 10:20

4 294 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot

... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ GTL 121 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ GCL ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ GTE 61 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCCA...

Ngày tải lên: 07/03/2014, 12:20

16 397 0
w