Báo cáo khoa học: " Penetration of the English language in science: the case of a German national interdisciplinary critical care conference" docx

... found that about one-quarter of the abstracts presented at a German medical conference werewritten in English, indicating a significant penetration of the English language into a German national ... German national interdisciplinary medical conferencethat has been attended mostly by German- speakinginvestigators was astounding. The fact that about one-quarter of the abstracts were presented in ... 656 Critical Care December 2005 Vol 9 No 6 Falagas et al.There is a growing debate around the world about the rapid penetration of the English language into various expressions of human activity,...

Báo cáo khoa học: 2-Oxo acid dehydrogenase complexes in redox regulation Role of the lipoate residues and thioredoxin pot

... lipoylateddomains) [38], the physiological advantage of the E2 with the three lipoyl domains cannot be ascribed entirely to the catalytic role of these domains. Rather, the advantageappears to depend ... NADH/NAD+ratio and the complex-bound dihydro-lipoate/lipoate ratio. Redox state of the complex-boundlipoate is an indicator of the availability of the reactionsubstrates (2-oxo acid, CoA and ... pro-oxidant action of the radical [54], support the proposed mechanism of the inactivation (reaction 6).Catalysing the dismutation of the dihydrolipoate thyilradicals (Fig. 2), thioredoxin prevents...

Báo cáo khoa học: Succinate dehydrogenase ﬂavoprotein subunit expression in Saccharomyces cerevisiae – involvement of the mitochondrial FAD transporter, Flx1p ppt

... AAGGAATGTC CTTCCGTACCTCCAACTGTA AGAGCCTACG CCGGTGCTGG ATCCGGT-3¢); and S2-SDH1-HA (5¢-TGCAATTAAA GAAGAGTATG ATATTCTTTT CCGTAAAATA CAATGAG-GTT CAAAGCATAG GCCACTAGTG GATCTG-3¢). The WT and EBY167-G418Sstrains ... 5¢-TTAGTAGGCT CTTACAGTTG GAGGTACGGA AGGACATTCC TTTTCGTCCA GCATAGGCCA CTAGTGGATC-3¢. The WT strain was transformed according to Gietz & Woods[52]. PCR analysis and on-plate b-Gal assays ... WT-HA strain or in the ﬂx1D-HA strain. These experi-ments also showed that the availability and attachment of ﬂavin cofactors are not involved in the regulation of Sdh1p reduction. Using their...

Báo cáo khoa học: "Combining Source and Target Language Information for Name Tagging of Machine Translation Output" ppt

... 1171 of them are the same. This means that 38.14% of the names tagged in the target language and 40.5% of those in the source language do not have a corresponding tag in the other language, ... we are interested not only in training a module, but also in measuring the different performance for different scales of training corpora. If a small annotated corpus can get reasonable gain, ... source language information. In the nist05 data, we find 1893 named entities in the English NER output (target language part) and 1968 named entities in the ET output (source language part);...

Báo cáo khoa học: "Sparse Information Extraction: Unsupervised Language Models to the Rescue" pptx

... Foundations of Statistical Natural Language Processing.M. Pas¸ca, D. Lin, J. Bigham, A. Lifchits, and A. Jain.2006. Names and similarities on the web: Fact extrac-tion in the fast lane. In Procs. ... in the corpus that each extrac-tion appears in a context in which a seed also ap-pears (cf. (Ravichandran et al., 2005)). The ﬁrstadvantage of HMM-T is efﬁciency, as the traditionalapproach ... language models, as embodied in the REALM system, are aneffective means of assessing sparse extractions.Another attractive feature of REALM is its scal-ability. Scalability is a particularly important...

Báo cáo khoa học: "Choline PET based dose-painting in prostate cancer - Modelling of dose effects" potx

... 2003,57(4):1116-1121.48. Valdagni R, Italia C, Montanaro P, Lanceni A, Lattuada P, Magnani T,Fiorino C, Nahum A: Is the alpha-beta ratio of prostate cancer really low? A prospective, non-randomized trial comparing ... corresponding ASTRO value.Based on these assumptions the gain of a SIB is low,as the initial TCP is again very high (97.0%) and as the remaining SIB effect is smal l (1.4%). Again, this result is in ... model and wrote the manuscript. PB participated in the preparation of the manuscript. UG and CBprovided the idea and participated in the conception as well as the preparation of the manuscript. All...

Báo cáo khoa học: "Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its Management" doc

... Southern China, particularly in Guangdong province and in the northern parts of Africa and Inuits of Alaska[1]. Till date radiotherapy remains the mainstay treatment of NPC[2]. A definitive radiation ... determinants. Br J Radiol 1992, 65:710-714. 6. Rubenstein LJ: Radiation changes in intracranial neoplasms and the adjacent brain. In Book Radiation changes in intracranial neoplasms and the adjacent ... T, Yamada Y, Hyodo A, Nose T, Ishikawa H, Hatakeyama R: The role of thallium-201 single photon emission tomography in the investigation and characterisation of brain tumours in man and their...

Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

... of dominants thanthose in the annual treatment, both in sum-mer and in winter. The larger number of dominants in the biannual coppice than in the annual coppice can ... total biomass. Total biomass production of the biannual treatment was 78% of the pro-duction of the annual treatment in the sec-ond year, 26% in the third year, and ... cycle. The results clearly showed a decrease in biomass production and an increase in stool mortality in the biannual coppicingtreatment. In the absence of physiological studieson...

báo cáo khoa học: "Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin" potx

... deacety lases [HDACs])[7]. HATs are in charge of histone acetylation, leading to the relax ation of chromatin structure and transcriptionalactivation of genes, while HDACs are in charge of ... unmethylated form(154 bp) were tgtgatgtgtttgtattttgtggtt (positive sense) andccatacaataaccaaacaaccaa (antisense). The amplification wasperformed in an Mastercycler unit (Eppendorf) under the program ... 211:133-143.27. Ogawa M, Sakashita K, Zhao XY, Hayakawa A, Kubota Takeo, Koike K:Analysis of histone modification around the CpG island region of the p15 gene in acute myeloblastic leukemia. Leuk Res...

Báo cáo khoa học: "Metabolism during anaesthesia and recovery in colic and healthy horses: a microdialysis study" docx

... citation purposes)Example of lactate, glucose, and urea changes in dialysate and plasma in a colic horseFigure 6Example of lactate, glucose, and urea changes in dialysate and plasma in a colic ... necessarily plasma lactate, compared to that in horseswith a perfect and easy recovery.Lactate-to-pyruvate ratioPyruvate, the precursor of lactate, and the La/Py ratio havegained increasing interest ... standard error of means (SEM).For the statistical analyses, the plasma sample taken at 15minutes after standing was compared to the dialysatesample collected when the horse regained the standingposition...

Xem thêm