Báo cáo khoa học: " Application of a population-based severity scoring system to individual patients results in frequent misclassification" doc

Báo cáo khoa học: " Application of a population-based severity scoring system to individual patients results in frequent misclassification" doc

Báo cáo khoa học: " Application of a population-based severity scoring system to individual patients results in frequent misclassification" doc

... 5 Research Application of a population-based severity scoring system to individual patients results in frequent misclassification Frank V Booth 1 , Mary Short 2 , Andrew F Shorr 3 , Nancy Arkins 4 , ... USA 3 Associate Director of Pulmonary Critical Care Medicine, Pulmonary and Critical Care Medicine, Washington Hospital Center, Washington, DC, USA and Associate P...
Ngày tải lên : 12/08/2014, 22:22
  • 8
  • 241
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1...
Ngày tải lên : 18/02/2014, 14:20
  • 16
  • 646
  • 0
báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

báo cáo khoa học: " Development of a novel data mining tool to find cis-elements in rice gene promoter regions" pdf

... J, Nakamura M, Hirozane-Kishikawa T, Kanagawa S, Arakawa T, Taka- hashi-Iida J, Murata M, Ninomiya N, Sasaki D, Fukuda S, Tagami M, Yamagata H, Kurita K, Kamiya K, Yamamoto M, Kikuta A, Bito T, Fujitsuka ... whole* 2 Lift ATCIS Description ACACAC 10 6056 1.353 PRHA BS in PAL1* 3 ATACACA 5 2124 1.929 PRHA BS in PAL1 ATACACAC 3 739 3.326 PRHA BS in PAL1 TACACAC 4 1786 1.835 PRHA BS in...
Ngày tải lên : 12/08/2014, 05:20
  • 10
  • 397
  • 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... orientation of vitamin B 12 on binding and number of combining sites of human intrin- sic factor and the transcobalamins. Biochim Biophys Acta 243, 75–82. 12 Marchaj A, Jacobsen DW, Savon SR & ... E & Petersen TE (2002) Comparative analysis of cobalamin binding kinetics and ligand protection for intrinsic factor, transcobalamin, and haptocorrin. J Biol Chem 277, 9989–9996. 15...
Ngày tải lên : 19/02/2014, 05:20
  • 12
  • 603
  • 0
Báo cáo khoa hoc:" Application of a biotin functionalized QD assay for determining available binding sites on electrospun nanofiber membrane" pdf

Báo cáo khoa hoc:" Application of a biotin functionalized QD assay for determining available binding sites on electrospun nanofiber membrane" pdf

... nanofiber mats. It is anticipated that measurement of binding sites on a planar system using this method would maintain a linear response then plateau at a saturation Table 1 Calculated femtomoles ... The avidin protei n can be attached to a surface and still mai ntain the biotin binding functionality allow- ing attachment of biotin labeled receptors. The strong binding affini...
Ngày tải lên : 11/08/2014, 08:20
  • 7
  • 237
  • 0
Báo cáo khoa học: "Application of a zona pellucida binding assay (ZBA) in the domestic cat benefits from the use of in vitro matured oocytes" pptx

Báo cáo khoa học: "Application of a zona pellucida binding assay (ZBA) in the domestic cat benefits from the use of in vitro matured oocytes" pptx

... there was no sperm-zona binding at all. This may partly be due to changes in the capacity of spermatozoa to maintain a normal plasma membrane surface that could bind to the specific receptors present ... in ZP binding registered. However, the lack of binding to FT ZP is mainly due to the ZP and not to the spermatozoa, since fresh spermatozoa also had markedly decreased b...
Ngày tải lên : 12/08/2014, 18:22
  • 7
  • 299
  • 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

... comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG. The deletion was constructed in CVR69L and JB69 to generate CVR69LDrnc ... CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT. The resulting vector was termed pTrc9 9a: :era. Protein overexpression was assayed by SDS ⁄ PAGE. Sele...
Ngày tải lên : 06/03/2014, 00:21
  • 12
  • 439
  • 0
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

... revealed the disap- pearance of ADP and the formation of an ATP peak, which was identified in the chromatogram using the same criteria as for ADP and inosine. CE analysis All of the above compounds ... containing various amounts of AdK (0.1–4.0 nmol in a final volume of 0.25 mL) and a fixed amount of MK (0.0008 nmol) in the absence of ADA. Inset: Scatchard plot. D. Vannon...
Ngày tải lên : 23/03/2014, 06:20
  • 15
  • 378
  • 0
Báo cáo khoa học: Characterization of a-synuclein aggregation and synergistic toxicity with protein tau in yeast potx

Báo cáo khoa học: Characterization of a-synuclein aggregation and synergistic toxicity with protein tau in yeast potx

... (2004) Accelerated alpha-synuclein aggregation after differen- tiation of SH-SY5Y neuroblastoma cells. Brain Res 1013, 51–59. 57 Matsuzaki M, Hasegawa T, Takeda A, Kikuchi A, Fur- ukawa K, Kato Y & ... observations sugges- ted that it also has a role in PD [49]. As in mammalian cells, autophagy in yeast is induced by rapamycin- dependent inhibition of the Tor kinases [46]. I...
Ngày tải lên : 23/03/2014, 13:20
  • 15
  • 364
  • 0
Từ khóa: