Báo cáo khoa học: "Critical care transfers – a danger foreseen is half avoided" pdf

... discomfort necessary to finally stimulate improvement. Commentary Critical care transfers – a danger foreseen is half avoided Philip Haji-Michael Consultant in Critical Care Medicine and Anaesthesia, ... and fixed appropriately. Noncompliance will technically invalidate any EU ambulance’s motor insurance policy. Each hospital must nominate a specialist with responsibilit...

Ngày tải lên: 12/08/2014, 22:22

... to augment critical care capacity, so critical care health care professionals must take the lead for planning and preparing to care for numbers of seriously ill patients that far exceed available ... disasters have had to forgo acceptable critical care because of staff or resource shortages [1-7]. In contrast, a naturally occurring disease outbreak or a deliberate epidemic resul...

Ngày tải lên: 12/08/2014, 22:21

... journals. Critical Care has continued with its initial mission set out 10 years ago, namely to serve as an educational online forum, and it now publishes a wide range of articles to meet the needs of a large ... impact factor of 3.21 (ranking us third in the field) proves that Critical Care – an online, open access journal – can compete alongside the older, more established, t...

Ngày tải lên: 12/08/2014, 23:22

... CGCTATTACCATGGTGATGC (nucleotides 458 8–4 608 of PCMV-Sport–b-gal plasmid) Sense ARS with PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc Antisense ... overall CMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal...

Ngày tải lên: 18/02/2014, 12:20

... translation. Com- putational Linguistics. Franz Josef Och, Kenji Yamada, Stanford U, Alex Fraser, Daniel Gildea, and Viren Jain. 2004. A smorgasbord of features for statistical machine translation. ... For each aligned paragraph pair (i.e. a simple paragraph and one or more normal paragraphs), we then used a dynamic programming approach to find that best global sentence alignment followi...

Ngày tải lên: 07/03/2014, 22:20

... densitometrically analyzed by using a digital camera and the software AIDA 2.0 (Raytest, Straubenhardt, Germany). Isolation and detection of APPsa by Western blot analysis Depending on each cell line an appropriate ... USA 96, 392 2–3 927. 28. Koike, H., Tomioka, S., Sorimachi, H., Saido, T.C., Maruyama, K.,Okuyama ,A. ,Fujisawa-Sehara ,A. ,Ohno,S.,Suzuki,K.& Ishiura, S. (1999) Membra...

Ngày tải lên: 08/03/2014, 02:20

... for English and 200k words for Arabic. As mentioned earlier, adding this data to the cascade model is a trivial task: the data just gets added to the train- ing data, and the model is retrained. ... between the AIO and the cascade models. When additional partially-labeled data was available, the cascade and joint models receive a statistically significant boost in performance, while th...

Ngày tải lên: 08/03/2014, 02:21

... application required for this task can also include codes indicating places in the string where other material may intervene, because this information is available in the relevant PIClass ... separable verbs in WM. The dots in the last line mark the absence of a line break in the actual code. Feature specifications separated by tabs refer to sets of formatives in paradigmatic variat...

Ngày tải lên: 17/03/2014, 07:20

... Kurabayashi N, Hirota T, Sakai M, Sanada K & Fuk- ada Y (2010) DYRK 1A and glycogen synthase kinase 3beta, a dual-kinase mechanism directing proteasomal degradation of CRY2 for circadian timekeeping. ... kinase could act at several levels in a multifaceted manner, integrat- ing several cellular responses within a given neuronal process. MNB ⁄ DYRK 1A also displays a rather varie...

Ngày tải lên: 22/03/2014, 16:21

... intralaminar and midline nuclei of the thala- mus. Anatomical and functional evidence for participa- tion in processes of arousal and awareness. Brain Res Rev 39, 10 7–1 40. 13 Pare D, Quirk GJ & ... other hand, the major inhibitory transmitter in the brain, GABA, is necessary to reduce cortical activity and plays an important role in sleep onset and mainten- ance. Acetylcholine (ACh)...

Ngày tải lên: 30/03/2014, 11:20