Báo cáo khoa học: "Correction: Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" ppsx

... procalcitonin and C-reactive protein, and similar to the AUC for the APACHE II score. Conclusion Pro-ANP appears to be a valuable tool for individual risk assessment in sepsis patients and for stratification ... women) included in the study was 57 ± 15 years (range 23–86 years) and the mean APACHE II score on admission was 22 ± 8. The median length of stay in...

Ngày tải lên: 12/08/2014, 20:20

Ngày tải lên: 12/08/2014, 22:21

... in healthy control individuals. Statistical analysis Data are expressed as mean ± standard deviation in the text and as median (range) in figures. Comparison of frequencies was done using the ... Marutsuka K, Nawa Y, Asada Y, Hara S, Kitamura K, Eto T, Sumiy- oshi A: Adrenomedullin and proadrenomudullin N-terminal 20 peptide (PAMP) are present in human colonic epithelia and exe...

Ngày tải lên: 12/08/2014, 23:20

... BR participated in study design construction, conducted statistical analysis, and participated in data analysis and manuscript writing. Acknowledgements We thank Dr David Baker, DM, FRCA (Department ... of classic heatstroke on serum procalcitonin. Crit Care Med 1997, 25:1362-1365. 17. Kylanpaa-Back ML, Takala A, Kemppainen EA, Puolakkainen PA, Leppaniemi AK, Karonen SL, Orpana A, Haapi...

Ngày tải lên: 13/08/2014, 03:21

... (hugodandrea@ciudad.com.ar) Natalia Bello (nataliasbello@yahoo.com.ar) Marta Mollerach (martamollerach@gmail.com) Carlos Vay (cavay@fibertel.com.ar) Maria Beatriz Lasala (mblasala@fibertel.com.ar) Angela ... below). Articles in Journal of Medical Case Reports are listed in PubMed and archived at PubMed Central. For information about publishing your research in Journal of Medical Case Re...

Ngày tải lên: 10/08/2014, 22:20

... pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and Mauro Fasano 1 1 Department of Structural and ... VDAC-2) and ten proteins [pyruvate kinase, 60S acidic ribosomal protein P2 (RPLP2), eukaryotic initiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12, annexin A2 , annexin A5 , aldo...

Ngày tải lên: 15/02/2014, 01:20

... coenzyme analog lacking the ade- nine ring in the upper axial ligand; a model of damaged cofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing the adenine ring ... forming a cavity  11 A ˚ in height. The size of this cavity is comparable with that of adenine- lacking cobalamins, and thus allows the damaged cofactor to pass th...

Ngày tải lên: 15/02/2014, 01:20

... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGG...

Ngày tải lên: 19/02/2014, 05:20

... interact with microorganisms [58] and enhance phagocytosis of bacteria by hemocytes [59]. Also it is known that the hepatopancreas sequesters both extraneous proteins and the bacteria invading the ... It is highly likely that sialic acid-binding lectins in crab may recognize and bind to such organisms that contain sialic acid [12]. Lectins have the ability to agglutinate bac...

Ngày tải lên: 21/02/2014, 00:20

... CARP, together with ankyrin repeat domain- containing protein 2 (Ankrd2) and diabetes-related ankyrin repeat protein, forms a family of transcription regulators known as muscle ankyrin repeat ... by automated sequencing. AAV2/1 viral preparations were generated by packaging AAV2-inverted terminal repeat recombinant genomes in AAV1 capsids using a three-plasmid transfection protocol as ....

Ngày tải lên: 07/03/2014, 03:20