Báo cáo khoa học: "Correction: Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" ppsx
Báo cáo y học: "Pro-atrial natriuretic peptide is a prognostic marker in sepsis, similar to the APACHE II score: an observational study" pptx
... procalcitoninand C-reactive protein, and similar to the AUC for the APACHE II score.Conclusion Pro-ANP appears to be a valuable tool for individual risk assessment in sepsis patients andfor stratification ... women)included in the study was 57 ± 15 years (range 23–86 years)and the mean APACHE II score on admission was 22 ± 8. The median length of stay in the medical ICU was 4 days (range0.2–60 days) and the ... [20]. As a modification to the published assay, the calibration was changed from a synthetic peptide to pro-ANP in human serum. This modification to the initial descriptionincreased the precision...
- 9
- 254
- 0
Báo cáo khoa học: "Mid-regional pro-adrenomedullin as a prognostic marker in sepsis: an observational study" pot
... in healthy control individuals.Statistical analysisData are expressed as mean ± standard deviation in the textand as median (range) in figures. Comparison of frequencieswas done using the ... Marutsuka K, Nawa Y, Asada Y, Hara S, Kitamura K, Eto T, Sumiy-oshi A: Adrenomedullin and proadrenomudullin N-terminal 20 peptide (PAMP) are present in human colonic epithelia andexert an antimicrobial ... study was 57 ± 15 (range 23–86) years. Onadmission, the mean APACHE II score was 22 ± 8 points and the mean SAPS II score was 53 ± 18 points. The medianlength of stay in the ICU was 4 days (range...
- 9
- 231
- 0
Báo cáo khoa học: " Serum procalcitonin measurement as diagnostic and prognostic marker in febrile adult patients presenting to the emergency department" pdf
... BR participated in study designconstruction, conducted statistical analysis, and participated in data analysis and manuscript writing.AcknowledgementsWe thank Dr David Baker, DM, FRCA (Department ... ofclassic heatstroke on serum procalcitonin. Crit Care Med1997, 25:1362-1365.17. Kylanpaa-Back ML, Takala A, Kemppainen EA, Puolakkainen PA,Leppaniemi AK, Karonen SL, Orpana A, Haapiainen RK, ... bacterial/parasitic infection (univariate analysis) and identification of variables predictive of bacterial/parasitic infection after stepwise logistic regression analysis (multivariate analysis)Variable...
- 9
- 343
- 0
báo cáo khoa học: "Correction: Endocarditis caused by methicillin-susceptible Staphylococcus aureus with reduced susceptibility to vancomycin: a case report" ppt
... (hugodandrea@ciudad.com.ar)Natalia Bello (nataliasbello@yahoo.com.ar)Marta Mollerach (martamollerach@gmail.com)Carlos Vay (cavay@fibertel.com.ar)Maria Beatriz Lasala (mblasala@fibertel.com.ar)Angela ... below).Articles in Journal of Medical Case Reports are listed in PubMed and archived at PubMed Central.For information about publishing your research in Journal of Medical Case Reports or any BioMedCentral ... This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon.Correction: Endocarditis caused...
- 2
- 266
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia Bruna Gariboldi1,Giovanna Tosi3, Leonardo Lopiano4and Mauro Fasano11 Department of Structural and ... VDAC-2) and ten proteins [pyruvate kinase, 60Sacidic ribosomal protein P2 (RPLP2), eukaryoticinitiation factor 5A (eIF 5A) , parathymosin, L7 ⁄L12,annexin A2 , annexin A5 , aldolase A, fascin ... oxidation that activates apoptosis and induces the synthesis of antioxidants [22].Alterations in mitochondrial proteins, on the otherhand, are specifically linked to one of the major patho-genetic...
- 11
- 775
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... coenzyme analog lacking the ade-nine ring in the upper axial ligand; a model of damagedcofactors) for free adeninylpentylcobalamin (AdePeCbl) (an inactive coenzyme analog containing the adeninering ... forming a cavity 11 A ˚ in height. The size of this cavity is comparable with that of adenine-lacking cobalamins, and thus allows the damagedcofactor to pass through it. Intact cofactor, an ade-nine-containing ... Mechanism of action of adenosylcobalamin:glycerol and other substrate analogues as substrates andinactivators for propanediol dehydratase – kinetics,stereospecificity, and mechanism. Biochemistry...
- 13
- 620
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCCGCGGGATCCCGGATGCTGGCAGCGTGGGTTGGpYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGpEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTTGCGGGATCCCGTTTCCCAGCCTGTTGGGCCTpEGFP-N1 ⁄ PDIP46(1) ⁄ SKAR (a) AAACTGCAGGATGGCGGACATCTCCCTGGACAAACTGCAGAAGCTTGATTTTGAATTCTGTpEGFP-N1 ... GCGGGATCCCTCAGCCCATTGGAAGGCACCATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAGpYESTrp2 ⁄ PDIP46 ⁄ SKAR(E) GCGGGATCCAACAAGGAAGAACCCCCCATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCCpYESTrp2 ⁄ PDIP46⁄ SKAR(F) GCGGGATCCCTGGACGGGCAGCCGATGAAGATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGTpYESTrp2...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... interact withmicroorganisms [58] and enhance phagocytosis of bacteriaby hemocytes [59]. Also it is known that the hepatopancreassequesters both extraneous proteins and the bacteriainvading the ... It is highly likelythat sialic acid-binding lectins in crab may recognize andbind to such organisms that contain sialic acid [12]. Lectinshave the ability to agglutinate bacteria [56,57], interact ... structuralvariations and modifications of sialic acids and their linkage to the underlying sugar [7]. The most common sialic acidfound in sialoproteins and gangliosides of human tissues is NeuAc....
- 8
- 616
- 0
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... CARP, together with ankyrin repeat domain-containing protein 2 (Ankrd2) and diabetes-relatedankyrin repeat protein, forms a family of transcriptionregulators known as muscle ankyrin repeat ... by automated sequencing.AAV2/1 viral preparations were generated by packagingAAV2-inverted terminal repeat recombinant genomes in AAV1 capsids using a three-plasmid transfection protocolas ... for inverted terminal repeat amplification were:1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGCATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATTTable 1. Primers and...
- 16
- 428
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP