Báo cáo khoa học: "Protocol-directed weaning: a process of continuous performance improvem" ppsx

Báo cáo khoa học: "Protocol-directed weaning: a process of continuous performance improvem" ppsx

Báo cáo khoa học: "Protocol-directed weaning: a process of continuous performance improvem" ppsx

... sufficient ventilator-independent gas exchange to achieve acceptable ventilation and oxygenation after discontinuation, adequate cough, and good airway patency and protection. Because both longer duration of ventilation and ... rapid discontinuation [7]. Ely and colleagues [2] first showed that a combination of a daily screening checklist of easily measured parameters, followed by...

Ngày tải lên: 12/08/2014, 22:21

3 152 0
Báo cáo khoa học: "Long-term decomposition process of leaf litter from Quercus pyrenaica forests across a rainfall gradient (Spanish central system)" pps

Báo cáo khoa học: "Long-term decomposition process of leaf litter from Quercus pyrenaica forests across a rainfall gradient (Spanish central system)" pps

... system) A Martin JF Gallardo 2 I Santa Regina 1 Area de Edafolog a, Facultad de Farmacia, Universidad de Salamanca, 37080 Salamanca; 2 CSIC, Aptado 257, 37071 Salamanca, Spain (Received ... Cambisols (gen- erally humic) developed over slates and greywackes at Navasfrías and Villasrubias and over Ca-alkaline granite at El Payo and Fuenteguinaldo (Gallar...

Ngày tải lên: 08/08/2014, 18:21

12 304 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into the EcoRV site of ... that mammalian Gup1, a mem- ber of the MBOAT superfamily bearing sequence simi- larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports have demo...

Ngày tải lên: 18/02/2014, 16:20

14 501 0
Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf

Tài liệu Báo cáo khoa học: "The Structure and Process of Talking About Doing" pdf

... ~Ant about 5h ~a ~rt~e~ar example %8 5hat ~t %e embedded wlthAn an "el~mlnatAon of alternat£voo" arll~Nnt etruoture. The5 %a, 5hAm "prqitAo arluaent" 18 used 50 el~aAnaSe ... name tank. Than %e the evaluatAon 5eat oemmon%y used today For strafe.sial AntelIA|enee models. A more r~l;orous 5eat %e 5n Cry to F~.5 a mode/. 50 • emma OF data. ?hAs ~e the evalua...

Ngày tải lên: 21/02/2014, 20:20

4 585 0
Báo cáo khoa học: "Beyond NomBank: A Study of Implicit Arguments for Nominal Predicates" doc

Báo cáo khoa học: "Beyond NomBank: A Study of Implicit Arguments for Nominal Predicates" doc

... Haji ˇ c, Massimiliano Ciaramita, Richard Johans- son, Daisuke Kawahara, Maria Ant ` onia Mart ´ ı, Llu ´ ıs M ` arquez, Adam Meyers, Joakim Nivre, Sebastian Pad ´ o, Jan ˇ St ˇ ep ´ anek, Pavel ... annotated instances. In contrast, our study focused on a se- lect group of nominal predicates, each associated with a large number of annotated instances. 3 Data annotation and analysis 3....

Ngày tải lên: 17/03/2014, 00:20

10 402 0
Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

... service takes a Portuguese nomi- nal form — a form of a noun or an adjective, in- cluding adjectival forms of past participles –, to- gether with a bundle of inflectional feature values — values of ... The name- based component is built upon HMMs with the help of TnT (Brants, 2000). It was trained over a manually annotated corpus of approximately 208,000 words, and evalua...

Ngày tải lên: 17/03/2014, 02:20

4 299 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT Vps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC YEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG IRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table 3. Pla...

Ngày tải lên: 23/03/2014, 09:20

14 362 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

... (pNPa GlcNAc), a- d-xyl opyranose (pNPaXyl), a- d-manno- pyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNP aAraf) and a- l-rhamnopyra- nose (pNPaRha) (less than 10 lm pNP liberated ... trehalose, turanose, raffi- nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc, pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St. Louis, MO, USA...

Ngày tải lên: 29/03/2014, 21:20

14 579 0
Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx

Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx

... can motivate a speaker to use a variant in place of a canonical form (Glucksberg, 1993). Nevertheless, lexical and syntactic flexibility may well be used as partial indicators of semantic ana- lyzability, ... the beans has an idiomatic meaning (“to reveal a secret”), while spill the peas and spread the beans have only literal interpretations. Idiomatic combinations are also syntact...

Ngày tải lên: 31/03/2014, 20:20

8 295 0
báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx

... the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas the labia ... complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mass...

Ngày tải lên: 10/08/2014, 22:20

14 367 0
w