Báo cáo y học: "Commentary – a Potato, potšto, proxy consent, permission – just don’t call the whole thing off" potx
Báo cáo y học: "Commentary – a Potato, potšto, proxy consent, permission – just don’t call the whole thing off" potx
... have wanted to participate in such research, and require assurance that designated safeguards are in place [14], or they may be unable to give permission at all. The legal and ethical acceptability ... enabled, clear and justifiable parameters must be created and, where they are already established, they must be made more transparent. Competing interests The author(s) declare that they...
Ngày tải lên: 12/08/2014, 20:21
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx
... D1 1–1 3 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse ... (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D4 5–4 7; forward primer D1...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo y học: " XGAP: a uniform and extensible data model and software platform for genotype and phenotype experiments" potx
... (standalone). A Java class is generated for each data type - for example, there is a class Gene. All data can be queried programmati- cally via a central Database class, that is, command db. find(Gene.class) ... in their investigation from (or to) their XGAP database for (after) analysis in R. When XGAP is custo- mized with additional data type variants, the APIs are automatically ext...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: " Hematemesis, a very rare presentation of solid pseudo-papillary tumors of the pancreas: a case report" pdf
... Theodossis S Papavramidis* - papavramidis@hotmail.com; Akis Zatagias - zatagias@yahoo.com; Antonis Michalopoulos - amichal@med.auth.gr; Vassilis N Papadopoulos - bnpap2003@yahoo.com; Daniel Paramythiotis ... of the pancreas: a case report Stylianos Apostolidis, Theodossis S Papavramidis*, Akis Zatagias, Antonis Michalopoulos, Vassilis N Papadopoulos, Daniel Paramythiotis and Nick Harl...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo y học: "Phytalgic®, a food supplement, vs placebo in patients with osteoarthritis of the knee or hip: a randomised double-blind placebo-controlled clinical trial" potx
... by Laboratoires Phythea. Laurent Mallet is an employee of Laboratoire Phythea. Alain Jacquet is the main clinical investigator, and was compensated by Labora- toire Phythea for the time and activities ... of the knee and/or hip, which is an advantage and a drawback: an advan- tage because it can be seen as a real-life population, increas- ing generalisability of the results, a d...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Pro/con debate: Should antimicrobial stewardship programs be adopted universally in the intensive care unit" potx
... hospitalisation and other infrastructure costs are also increased, ultimately resulting in a greater strain on the healthcare system. Saving antibiotics will save money, and there are a variety of methods ... of a large multi-disciplinary ICU. You have recently read that hospital-wide antibiotic stewardship programs have the potential to improve the quality and safety of care...
Ngày tải lên: 13/08/2014, 20:21
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. Many recent ... 1. Renal Data System. USRDS 2003 annual data report: atlas of end-stage renal disease in the United States. Bethesda: National Institutes of Health, National Institute of Diabetes...
Ngày tải lên: 03/11/2012, 11:52
Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot
... human chymase [37,38]. They hydrolyzed the methylated substrate MeO-succinyl-Ala- Ala-Pro-Val-pNA more effectively than the unmethylated succinyl-Al-Ala-Pro-Val-pNA, predominantly due to the lower ... 15, 43 1–4 40. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pharma...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... TAA (in black). The superimpositioning was guided by the catalytic acids (D179 AMY2 , E204 AMY2 , and D289 AMY2 and D206 TAA , E230 TAA , and D297 TAA ). The invariant Y5 1 AMY2 and Y8 2 TAA are ... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AM...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx
... cells transformed by X-ray, UV-C, and 3-methylcholanthrene, detected by a DNA fingerprint assay. Cancer Res. 52, 578 8–5 793. 12. Kitazawa, T., Kominami, R., Tanaka, R., Wakabayashi, K. & Nagao, ... cytoplasmic extraction. The same membrane was used for immunoblot analysis with aF-N, aF-C and anti- (a- tubulin) Ig. Lanes 1 and 4, whole cell lysate; lanes 2 and 5, cytoplasmic fracti...
Ngày tải lên: 31/03/2014, 23:20