Báo cáo khoa học: " Safety and efficacy of analgesia-based sedation with remifentanil versus standard hypnotic-based regimens in intensive care unit patients with brain injuries: a randomised, controlled trial [ISRCTN50308308]" pps

Báo cáo khoa học: " Safety and efficacy of analgesia-based sedation with remifentanil versus standard hypnotic-based regimens in intensive care unit patients with brain injuries: a randomised, controlled trial [ISRCTN50308308]" pps

Báo cáo khoa học: " Safety and efficacy of analgesia-based sedation with remifentanil versus standard hypnotic-based regimens in intensive care unit patients with brain injuries: a randomised, controlled trial [ISRCTN50308308]" pps

... remifentanil versus standard hypnotic-based regimens in intensive care unit patients with brain injuries: a randomised, controlled trial [ISRCTN50308308] Andreas Karabinis 1 , Kostas Mandragos 2 , Spiros ... of analgesia-based sedation with conventional hypnotic-based sedation in patients with brain injuries requiring sedation dur- ing...
Ngày tải lên : 12/08/2014, 20:20
  • 13
  • 194
  • 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"

Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"

... preliminary human and animal trials have shown it to be effective in treating osteoarthritis (OA). The present clinical trial evaluated the safety and efficacy of UC-II as compared to a combination ... currently available for OA, individualized treatment programs are available to help relieve pain and stiffness, and to maintain and/ or improve func- tional status. In...
Ngày tải lên : 26/10/2012, 09:48
  • 10
  • 706
  • 0
Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot

Báo cáo y học: " Safety and efficacy of a generic fixed-dose combination of stavudine, lamivudine and nevirapine antiretroviral therapy between HIV-infected patients with baseline CD4 " pot

... Sirirat Likanonsakul 1 and Somnuek Sungkanuparph 2 Address: 1 Bamrasnaradura Infectious Diseases Institute, Ministry of Public Health, Nonthaburi, 11000, Thailand and 2 Faculty of Medicine Ramathibodi ... Intention-to-treat analysis ** On-treatment analysis BioMed Central Page 1 of 8 (page number not for citation purposes) AIDS Research and Therapy Open Access Research Safet...
Ngày tải lên : 10/08/2014, 05:20
  • 8
  • 371
  • 0
báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt

báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt

... Belgium) and commercially sequenced. Sequences were analyzed with BLASTn and BLASTx http://www.ncbi.nlm.nih.gov/BLAST/ programs against the GenBank database, and against a banana EST database donated ... http://www.dna.affrc.go.jp/PLACE/ databases, and analyzed with the TSSP http://www.softberry.com software. Cloning and back-transformation of tagged sequences A 1742 bp...
Ngày tải lên : 12/08/2014, 03:20
  • 15
  • 283
  • 0
Báo cáo khoa học: "Isolation and characterization of Treponema phagedenis-like spirochetes from digital dermatitis lesions in Swedish dairy cattle" pps

Báo cáo khoa học: "Isolation and characterization of Treponema phagedenis-like spirochetes from digital dermatitis lesions in Swedish dairy cattle" pps

... EU375744 and EU410484. BioMed Central Page 1 of 8 (page number not for citation purposes) Acta Veterinaria Scandinavica Open Access Research Isolation and characterization of Treponema phagedenis-like ... sus- pended in both isotonic saline (pH 6.3) and phosphate buffered saline (PBS, pH 7.3) and incubated both aerobi- cally and anaerobically. As control strain the recom- mend...
Ngày tải lên : 12/08/2014, 18:22
  • 8
  • 424
  • 0
báo cáo khoa học: " Prevalence and consequences of patient safety incidents in general practice in the Netherlands: a retrospective medical record review study" potx

báo cáo khoa học: " Prevalence and consequences of patient safety incidents in general practice in the Netherlands: a retrospective medical record review study" potx

... most of their medical care in general practice, but to date adequate data on the prevalence of patient safety incidents in general practice are not available [2,3]. In the Netherlands, all citizens are ... [13]. Sample of patients and practices A stratified sample of general practices in the Nether- lands was adopted in order to obtain a nationally repre- sentati...
Ngày tải lên : 10/08/2014, 10:23
  • 7
  • 310
  • 1
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... DHSs observed in mammalian cytokine genes [91]. NFAT, in turn, plays a major role in assisting the binding of AP-1 via cooperative binding, and creates an accessi- ble environment that also enables Sp1 and ... these advances have been accompanied by a relative decrease in the number of studies aimed at gaining an understanding of the structural conformation of chromati...
Ngày tải lên : 14/02/2014, 18:20
  • 29
  • 743
  • 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a 3´ ... signaling pathway, (D) Hippo signaling pathway, (E) TGF-b signaling pathway, (F) Hh signaling pathway, and (G) Wnt signaling pathway. miRNAs and cell signaling A. Ichimura et a...
Ngày tải lên : 14/02/2014, 19:20
  • 9
  • 684
  • 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: ... CACGAG-3¢;TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; c...
Ngày tải lên : 18/02/2014, 04:20
  • 11
  • 653
  • 0
Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx

... similar amino acid variable and size change variable, as large changes in property and size of an amino acid residue could affect the protein negatively. The novel variables, the calculated energy ... (A) Average and individual weights for all parameters for each promoter. Values are sorted in descending order according to the absolute value of the average weight. (B) Average a...
Ngày tải lên : 18/02/2014, 11:20
  • 14
  • 561
  • 0

Xem thêm

Từ khóa: