Báo cáo khoa học: " A cross-sectional study of Tritrichomonas foetus infection among healthy cats at shows in Norwa" ppt

Báo cáo khoa học: " A cross-sectional study of Tritrichomonas foetus infection among healthy cats at shows in Norwa" ppt

Báo cáo khoa học: " A cross-sectional study of Tritrichomonas foetus infection among healthy cats at shows in Norwa" ppt

... analysis was performed using the softwar e package Stata 11 (Stata Statistical Software, Stata Cor- poration, College Station, TX, USA). The relationship between weight and PCR status was analysed ... at the time of sample collection. Moreover, in Norway, cats participating in shows are subjected to a health check by a veterinarian and only cats found healthy are allowed i...

Ngày tải lên: 12/08/2014, 18:22

6 197 0
báo cáo khoa học: " A qualitative exploration of prescription opioid injection among street-based drug users in Toronto: behaviours, preferences and drug availability" pdf

báo cáo khoa học: " A qualitative exploration of prescription opioid injection among street-based drug users in Toronto: behaviours, preferences and drug availability" pdf

... (CAMH). Results A total of 10 females and 15 males ranging in age from 18 to 50 years old (mean age of 33 years) participated in the study. The mean number of years using any drug was 21 years among the ... social processes which lead to initiation of crack use in inner-city environments have also been explored in a study by Fagan and Ko-lin who found that initiation...

Ngày tải lên: 11/08/2014, 18:20

10 194 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... 2007. c 2007 Association for Computational Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao * , Galen Andrew * , Mark Johnson *& , ... Newspaper). But in the linear model their feature weights were trained discriminatively on an adaptation domain corpus (Encarta Encyclopedia). Thus, this forms a cross...

Ngày tải lên: 08/03/2014, 02:21

8 505 0
Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf

Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf

... MCA can be a great help in determining potential target steps for metabolic engineering, because the reactions in the pathway that have the most potential of modifying a target flux or metabolite ... metabolism [9] and further examples of its application are given therein, as well as practical advice on isolation and assay of plant enzymes and extraction of metabolites. It shou...

Ngày tải lên: 16/03/2014, 18:20

7 414 0
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

... 2011. c 2011 Association for Computational Linguistics A Pilot Study of Opinion Summarization in Conversations Dong Wang Yang Liu The University of Texas at Dallas dongwang,yangl@hlt.utdallas.edu Abstract This ... chinese spoken document summarization. ACM Transactions on Asian Language Information Processing, 8(1). Chin-Yew Lin. 2004. ROUGE: a package for auto- matic evaluatio...

Ngày tải lên: 17/03/2014, 00:20

9 442 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Models of translational equiva- lence among words. Computational Linguistics, 26(2), pp. 221-249. F. J. Och. 2003. Minimum error rate training in statis- tical machine translat...

Ngày tải lên: 17/03/2014, 01:20

8 547 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... i.e. a disconnected MDP. This can be avoided by making sure that each action is avail- able at some state and that each state has at least one available action. We should now define the necessary ... years ADS have seen a lot of progress and have attracted the research community’s and industry’s interest. There is a number of available ADS, apply- ing state of the art technique...

Ngày tải lên: 17/03/2014, 22:20

10 499 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... (Tc00.1047053510659.240) was amplified by PCR from genomic DNA using the sense pri- mer 5¢-AAGCTTATGTCAACACGACGACTTATGCAC A- 3¢ and the antisense primer 5¢-GGATCCGGATCCTT AAGCCGTTCCCTGTTC-3¢ with additional HindIII and BamHI ... least adept of the ‘Tritryp’ parasites in metabolizing methylglyoxal, producing l-lactate rather than d-lactate. Restoration of a functional glyoxalase system...

Ngày tải lên: 23/03/2014, 06:20

11 640 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold. Cloned protein or mutation primer (5’- to 3’) F-TDPX1 TATAT CATATGTCTATCTACGACTTCAAGGTC R-TDPX1 ATATA GGATCCTCACGATTGAGTGCTT...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

... Protein concentration was 1 l M. Temperature was maintained at 27 °C using a water bath. Inset, absorption spectra of genistein (n)and daidzein (s) showing peak at 325 and 340 nm for genistein and daidzein, ... at 27 ± 0.2 °C on a Shimadzu RF 5000 spectrofluorimeter attached with UV polarizers (POLACOAT Co., Cincinatti, OH, USA). The temperature was maintained using a circu- lati...

Ngày tải lên: 23/03/2014, 11:20

17 457 0
w