Báo cáo khoa học: "Metabolism during anaesthesia and recovery in colic and healthy horses: a microdialysis study" docx
... 2 Lactate concentrations in dialysate and plasma in colic and healthy horses. The mean (± SEM) lactate concentra- tions in gluteal muscle dialysate and plasma in 8 colic horses (a) and in 10 healthy ... Veterinaria Scandinavica Open Access Research Metabolism during anaesthesia and recovery in colic and healthy horses: a microdialysis study Anna...
Ngày tải lên: 12/08/2014, 18:22
... The Authors Journal compilation ª 2010 FEBS in mammals, the crystallins are aA and aB; bB1, bB2, bB3, bA3 ⁄ A1 and bA4; and cA, cB, cC, cD, cE, cF and cS. In mice, the c-crystallins are the major ... Eiberg H, Andres L, Jiang H, Zheng G, Qian M et al. (2002) Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cata- ract. Nat Genet 31, 276...
Ngày tải lên: 18/02/2014, 04:20
... certainty, as defined by Kaplan and Zaenan [3] and Kaplan and Maxwell [2]. In this paper, we relate this characterization to that provided by Tree ~,djoining Grammars (TAG), showing a di- rect ... it as a variable that gets in- stantiated on adjoining. This treatment can be formalized by treating the auxiliary trees as func- tions over feature structures (by A- abstracti...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: The dipeptidyl peptidase IV family in cancer and cell biology pot
... gastroin- testinal tract, skin, lymph node, spleen, liver and lung, as well as in pancreatic acinar cells, adrenal gland, spermatogonia and spermatids of testis, and in Pur- kinje cells and in the granular ... the National Health and Medical Research Council of Australia for a postgraduate scholarship to DMTY and grants to MDG and GWM. TWY and NAN hold Australian Postg...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and ... (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAG...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Optimization of P1–P3 groups in symmetric and asymmetric HIV-1 protease inhibitors pptx
... protease gene was isolated by PCR with the upstream primer GAACA TATGGCCGATAGACAAGGAACTGTATCC and the downstream primer AGGGGATCCCTAAAAATTTAA AGTGCAACCAATCTG. The annealing site for the upstream ... mm in 3–4 weeks. Data collection and processing X-ray data were recorded on MAR-imaging plates on the synchrotron beam lines 9.5 DRAL at Daresbury, UK, DL41 and DW32 at Lure, France, and...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Regulation of matrix metalloproteinase activity in health and disease pdf
... hemopexin-like domain (C domain) of human gelatinase A (matrix metalloproteinase-2) requires Ca2+ for fibronectin and heparin binding. Binding properties of recombi- nant gelatinase A C domain to ... intra- cellular calcium-levels probably maintain MMP-26 in an inactive state and the active enzyme may only be seen during transient intracellular calcium in ux. An increased level of...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Modular kinetic analysis reveals differences in Cd2+ and Cu2+ ion-induced impairment of oxidative phosphorylation in liver pot
... Zita Nauciene 1,2 , Rasa Baniene 2 , Marijke J. Wagner 3 , Klaas Krab 3 and Vida Mildaziene 1 1 Centre of Environmental Research, Faculty of Natural Sciences, Vytautas Magnus University, Kaunas, ... modular kinetic analysis data, metabolic control analysis showed that Cd 2+ and Cu 2+ ions increased control of the respiratory and phosphorylation flux by the respiratory chain module (mainl...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx
... Carlsberg formed in anhydrous acetonitrile and in water. Proc Natl Acad Sci USA 95, 12918–12923. 33 Yennawar NH, Yennawar HP & Farber GK (1994) X-ray crystal-structure of gamma-chymotrypsin ... such as ethanol and acetonitrile. This may be because only a small amount of water is retained at the enzyme surface in the case of polar organic solvents relative to nonpolar organic s...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: "Changing of Women’s Roles in Agricultural and Handicraft Production: A Case Study in Kim Thieu Village, Tu Son District, Bac Ninh Province" pdf
... making only (loaned farmland to other villagers) 30 2. Craft making and rice cultivation in allocated land only 40 3. Craft making and rice cultivation in both allocated and borrowed land ... but mainly based on farming and craft making. However, agricultural 50 Changing of Women’s Roles in Agricultural and Handicraft Production: The traditional customs of a pa...
Ngày tải lên: 06/08/2014, 19:20