Báo cáo khoa học: "Few alterations in clinical pathology and histopathology observed in a CYP2C18&19 humanized mice model" pps
Báo cáo khoa học: "Few alterations in clinical pathology and histopathology observed in a CYP2C18&19 humanized mice model" pps
... for citation purposes)
Acta Veterinaria Scandinavica
Open Access
Research
Few alterations in clinical pathology and histopathology observed in
a CYP2C18&19 humanized mice model
Susanne Löfgren*
1
, ... CAATCTGTTCCATGATGGTTGATG
BAC3'endF AGACTGTGCTATCATGGGAACCAA 480
BAC3'endR GTTTTCTTGGGCTGAATGTCCTCT
2C18intron6F GGCAAGAAACACTTCATGAGCACT 429
2C18intron6R ATT...
Báo cáo khoa học: "Season of birth, clinical manifestations and Dexamethasone Suppression Test in unipolar major depression" docx
... and interpretation of data
and final formulation of the manuscript.
References
1. Glas G: A Conceptual History of Anxiety and Depression. Hand-
book of Depression and Anxiety - A Biological Approach ... clinical interview, any
recent suicidal attempt was registered as well as any simi-
lar attempt at any time point in the past. All attempts were
carried out by swallowing pills...
Báo cáo khoa học: "Genomic alterations of primary tumor and blood in invasive ductal carcinoma of breast" pdf
... hybridization in samples obtained from 30 breast cancer patients. The relative degree of chromosomal
changes was analyzed using log2 ratios and data was validated by real-time polymerase chain reaction.
Results: ... progression and poor prog-
nosis [39]. In addition, HDACs may also play important
roles in cancer development by regulating several genes
and causing abnormal gene sil...
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... observed, includ-
ing that Mxi1-SRa appears to be the predominant
transcript in the adult intestine and in the developing
embryo, whereas Mxi1-SRb transcripts predominate in
the adult liver and kidney ... was
generated by introducing the WR cDNA containing the full
5¢
-
UTR in pcDNA3.1. The coding region of Mxi1-SRa and
Mxi1-SRb were subcloned by PCR in a vector containing...
Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx
... a characteristic set of mass peaks in the range
of 5–10 kDa, typically including two dominating peaks
at approximately m ⁄ z 7000. As mycelia and spores
largely remained intact, and the extraction ... amounts) and requiring minimal sample
preparation. Bacterial intact-cell MALDI-TOF spectra
in the range 2–20 kDa are dominated by a set of ri-
bosomal proteins as highly abundant i...
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... caused by iron
loading has an impact in protein integrity, as indicated
by an increase in protein-bound acrolein adducts at
the cell surface, which point to acrolein-adducts as a
reliable marker ... immunoprecipitation and mRNA studies.
(A) Cytospins of HepG2 cells were incubated with Nor3.2 followed by rabbit anti-(mouse Igs) and the alkaline phosphatase-antialkaline phos-
phatase...
Tài liệu Báo cáo khoa học: Inhibitory properties of cystatin F and its localization in U937 promonocyte cells ppt
... human sali-
vary type cysteine proteinase inhibitors (cystatins) by an
Escherichia coli system and partial characterization of
recombinant cystatin S and its mutant (117 arginine fi
tryptophan). ... vesi-
cular staining of cystatin F was observed. Colocalization
of cystatin F with the lysosomal proteins LAMP-2
(Fig. 2A) and CD68 (Fig. 2B) revealed at least partial
endosomal ⁄ lysosomal...
Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx
... cataract development are
certain to emerge.
Cataract and a- crystallin post-
translational changes
Posttranslational modifications of aA- and aB-crystal-
lin, including truncation [33–37], deamidation ... eliminates chaperone activity,
suggesting a role in reduced lens transparency and
cataract [56]. Oxidation and transglutaminase induced
cross-linking may coordinately transform l...
Báo cáo khoa học: Post-ischemic brain damage: pathophysiology and role of inflammatory mediators ppt
... Minami M, Katayama T & Satoh M (2006) Brain
cytokines and chemokines: roles in ischemic injury and
pain. J Pharmacol Sci 100, 461–470.
111 Allan SM & Rothwell NJ (2001) Cytokines and acute
neurodegeneration. ... interleukin-1
receptor antagonist in plasma and cerebrospinal fluid
of patients following subarachnoid haemorrhage. Br J
Clin Pharmacol 65, 317–325.
Neuroinflammator...
Báo cáo khoa học: Enzymes of creatine biosynthesis, arginine and methionine metabolism in normal and malignant cells Soumen Bera1, Theo Wallimann2, Subhankar Ray1 and Manju Ray1 potx
... 3-methylcholanthrene; AGAT,
L-arginine:glycine amidinotransferase; CK, creatine kinase; CT-1, creatine transporter; EAC, Ehrlich
ascites carcinoma; GAA, guanidinoacetic acid; GAMT, N-guanidinoacetate ... sarcoma-bearing mice,
as well as from EAC and S180 cells. In addition, ornithine
and GAA were estimated also from the kidney of normal
and sarcoma-bearing mice.
Enzyme assay
AGAT...