Báo cáo khoa học: "Few alterations in clinical pathology and histopathology observed in a CYP2C18&19 humanized mice model" pps

... for citation purposes) Acta Veterinaria Scandinavica Open Access Research Few alterations in clinical pathology and histopathology observed in a CYP2C18&19 humanized mice model Susanne Löfgren* 1 , ... CAATCTGTTCCATGATGGTTGATG BAC3'endF AGACTGTGCTATCATGGGAACCAA 480 BAC3'endR GTTTTCTTGGGCTGAATGTCCTCT 2C18intron6F GGCAAGAAACACTTCATGAGCACT 429 2C18intron6R ATT...

Ngày tải lên: 12/08/2014, 18:22

... and interpretation of data and final formulation of the manuscript. References 1. Glas G: A Conceptual History of Anxiety and Depression. Hand- book of Depression and Anxiety - A Biological Approach ... clinical interview, any recent suicidal attempt was registered as well as any simi- lar attempt at any time point in the past. All attempts were carried out by swallowing pills...

Ngày tải lên: 08/08/2014, 23:20

... hybridization in samples obtained from 30 breast cancer patients. The relative degree of chromosomal changes was analyzed using log2 ratios and data was validated by real-time polymerase chain reaction. Results: ... progression and poor prog- nosis [39]. In addition, HDACs may also play important roles in cancer development by regulating several genes and causing abnormal gene sil...

Ngày tải lên: 09/08/2014, 03:21

... observed, includ- ing that Mxi1-SRa appears to be the predominant transcript in the adult intestine and in the developing embryo, whereas Mxi1-SRb transcripts predominate in the adult liver and kidney ... was generated by introducing the WR cDNA containing the full 5¢ - UTR in pcDNA3.1. The coding region of Mxi1-SRa and Mxi1-SRb were subcloned by PCR in a vector containing...

Ngày tải lên: 18/02/2014, 16:20

... a characteristic set of mass peaks in the range of 5–10 kDa, typically including two dominating peaks at approximately m ⁄ z 7000. As mycelia and spores largely remained intact, and the extraction ... amounts) and requiring minimal sample preparation. Bacterial intact-cell MALDI-TOF spectra in the range 2–20 kDa are dominated by a set of ri- bosomal proteins as highly abundant i...

Ngày tải lên: 19/02/2014, 02:20

... caused by iron loading has an impact in protein integrity, as indicated by an increase in protein-bound acrolein adducts at the cell surface, which point to acrolein-adducts as a reliable marker ... immunoprecipitation and mRNA studies. (A) Cytospins of HepG2 cells were incubated with Nor3.2 followed by rabbit anti-(mouse Igs) and the alkaline phosphatase-antialkaline phos- phatase...

Ngày tải lên: 19/02/2014, 16:20

... human sali- vary type cysteine proteinase inhibitors (cystatins) by an Escherichia coli system and partial characterization of recombinant cystatin S and its mutant (117 arginine fi tryptophan). ... vesi- cular staining of cystatin F was observed. Colocalization of cystatin F with the lysosomal proteins LAMP-2 (Fig. 2A) and CD68 (Fig. 2B) revealed at least partial endosomal ⁄ lysosomal...

Ngày tải lên: 19/02/2014, 17:20

... cataract development are certain to emerge. Cataract and a- crystallin post- translational changes Posttranslational modifications of aA- and aB-crystal- lin, including truncation [33–37], deamidation ... eliminates chaperone activity, suggesting a role in reduced lens transparency and cataract [56]. Oxidation and transglutaminase induced cross-linking may coordinately transform l...

Ngày tải lên: 19/02/2014, 18:20

... Minami M, Katayama T & Satoh M (2006) Brain cytokines and chemokines: roles in ischemic injury and pain. J Pharmacol Sci 100, 461–470. 111 Allan SM & Rothwell NJ (2001) Cytokines and acute neurodegeneration. ... interleukin-1 receptor antagonist in plasma and cerebrospinal fluid of patients following subarachnoid haemorrhage. Br J Clin Pharmacol 65, 317–325. Neuroinflammator...

Ngày tải lên: 07/03/2014, 03:20

... 3-methylcholanthrene; AGAT, L-arginine:glycine amidinotransferase; CK, creatine kinase; CT-1, creatine transporter; EAC, Ehrlich ascites carcinoma; GAA, guanidinoacetic acid; GAMT, N-guanidinoacetate ... sarcoma-bearing mice, as well as from EAC and S180 cells. In addition, ornithine and GAA were estimated also from the kidney of normal and sarcoma-bearing mice. Enzyme assay AGAT...

Ngày tải lên: 07/03/2014, 04:20