Báo cáo khoa học: "Few alterations in clinical pathology and histopathology observed in a CYP2C18&19 humanized mice model" pps
... for citation purposes) Acta Veterinaria Scandinavica Open Access Research Few alterations in clinical pathology and histopathology observed in a CYP2C18&19 humanized mice model Susanne Löfgren* 1 , ... CAATCTGTTCCATGATGGTTGATG BAC3'endF AGACTGTGCTATCATGGGAACCAA 480 BAC3'endR GTTTTCTTGGGCTGAATGTCCTCT 2C18intron6F GGCAAGAAACACTTCATGAGCACT 429 2C18intron6R ATT...
Ngày tải lên: 12/08/2014, 18:22
... and interpretation of data and final formulation of the manuscript. References 1. Glas G: A Conceptual History of Anxiety and Depression. Hand- book of Depression and Anxiety - A Biological Approach ... clinical interview, any recent suicidal attempt was registered as well as any simi- lar attempt at any time point in the past. All attempts were carried out by swallowing pills...
Ngày tải lên: 08/08/2014, 23:20
... hybridization in samples obtained from 30 breast cancer patients. The relative degree of chromosomal changes was analyzed using log2 ratios and data was validated by real-time polymerase chain reaction. Results: ... progression and poor prog- nosis [39]. In addition, HDACs may also play important roles in cancer development by regulating several genes and causing abnormal gene sil...
Ngày tải lên: 09/08/2014, 03:21
Tài liệu Báo cáo khoa học: Differential effects of Mxi1-SRa and Mxi1-SRb in Myc antagonism ppt
... observed, includ- ing that Mxi1-SRa appears to be the predominant transcript in the adult intestine and in the developing embryo, whereas Mxi1-SRb transcripts predominate in the adult liver and kidney ... was generated by introducing the WR cDNA containing the full 5¢ - UTR in pcDNA3.1. The coding region of Mxi1-SRa and Mxi1-SRb were subcloned by PCR in a vector containing...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Direct identification of hydrophobins and their processing in Trichoderma using intact-cell MALDI-TOF MS docx
... a characteristic set of mass peaks in the range of 5–10 kDa, typically including two dominating peaks at approximately m ⁄ z 7000. As mycelia and spores largely remained intact, and the extraction ... amounts) and requiring minimal sample preparation. Bacterial intact-cell MALDI-TOF spectra in the range 2–20 kDa are dominated by a set of ri- bosomal proteins as highly abundant i...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... caused by iron loading has an impact in protein integrity, as indicated by an increase in protein-bound acrolein adducts at the cell surface, which point to acrolein-adducts as a reliable marker ... immunoprecipitation and mRNA studies. (A) Cytospins of HepG2 cells were incubated with Nor3.2 followed by rabbit anti-(mouse Igs) and the alkaline phosphatase-antialkaline phos- phatase...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Inhibitory properties of cystatin F and its localization in U937 promonocyte cells ppt
... human sali- vary type cysteine proteinase inhibitors (cystatins) by an Escherichia coli system and partial characterization of recombinant cystatin S and its mutant (117 arginine fi tryptophan). ... vesi- cular staining of cystatin F was observed. Colocalization of cystatin F with the lysosomal proteins LAMP-2 (Fig. 2A) and CD68 (Fig. 2B) revealed at least partial endosomal ⁄ lysosomal...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx
... cataract development are certain to emerge. Cataract and a- crystallin post- translational changes Posttranslational modifications of aA- and aB-crystal- lin, including truncation [33–37], deamidation ... eliminates chaperone activity, suggesting a role in reduced lens transparency and cataract [56]. Oxidation and transglutaminase induced cross-linking may coordinately transform l...
Ngày tải lên: 19/02/2014, 18:20
Báo cáo khoa học: Post-ischemic brain damage: pathophysiology and role of inflammatory mediators ppt
... Minami M, Katayama T & Satoh M (2006) Brain cytokines and chemokines: roles in ischemic injury and pain. J Pharmacol Sci 100, 461–470. 111 Allan SM & Rothwell NJ (2001) Cytokines and acute neurodegeneration. ... interleukin-1 receptor antagonist in plasma and cerebrospinal fluid of patients following subarachnoid haemorrhage. Br J Clin Pharmacol 65, 317–325. Neuroinflammator...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Enzymes of creatine biosynthesis, arginine and methionine metabolism in normal and malignant cells Soumen Bera1, Theo Wallimann2, Subhankar Ray1 and Manju Ray1 potx
... 3-methylcholanthrene; AGAT, L-arginine:glycine amidinotransferase; CK, creatine kinase; CT-1, creatine transporter; EAC, Ehrlich ascites carcinoma; GAA, guanidinoacetic acid; GAMT, N-guanidinoacetate ... sarcoma-bearing mice, as well as from EAC and S180 cells. In addition, ornithine and GAA were estimated also from the kidney of normal and sarcoma-bearing mice. Enzyme assay AGAT...
Ngày tải lên: 07/03/2014, 04:20