Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx
Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx
... promoter+5' UTR RemarksiTriplet CCATATTAGGACATCTGCGT <20,1> modelPMSprune CCAAATTTG Ref. [17]MITRA CCATATTAGGACARef. [14]Published CAGGATGTCCATATTAGGACATC Transfac ID: R004663'UTR ... Research 2004, 14:1188-1190.20. Salgado H, Gama-Castro S, Martinez-Antonio A, Diaz-Peredo E,Sanchez-Solano F, Peralta-Gil M, Garcia-Alonso D, Jimenez-Jacinto V,Santos-Zavaleta A, Bonavides-Martinez ... ofsequencing data are readily available for analysis. Natural biological signals are intrinsically highlyvariable making their complete identification a computationally challenging problem. Many attemptsin...
- 14
- 262
- 0
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf
... reward rote recall of facts and don't assess a student's ability to apply knowledge in practice. The'Teaching Guide' emphasizes structured observation as analternative assessment ... Guide' places great emphasis on a mixof interactive teaching methods to stimulate active stu-dent participation, such as case-based learning, role plays,and group discussions. The 'Teaching ... PLWHA andhow to educate patients on specific meal preparation.To support faculty with up-to-date HIV/AIDS content, thecommittee drafted an 'HIV/AIDS Reference Manual' thatfeatures...
- 7
- 377
- 0
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... represent a substantial proportion of the hos-pital (antenatal and maternal and child health clinic; gen-eral outpatient/emergency area, maternity ward andpaediatric wards) and we achieved a very ... questions around organizationalcommitment with relatively high mean scores (Tables 1and 5). Qualitative data reveal that all health workers wereattracted to health care work by some aspect of ... wedeveloped an SAQ to assess motivation in hospital-basedKenyan health workers. Additionally, a comparison of thequantitative and qualitative results was made to helpunderstand the motivation score....
- 11
- 445
- 0
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
... Bronchoalveolar lavage (BAL) and serum sampleswere obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplexassay (Beadlyte Upstate, NY) for simultaneous quantitation ... data analyses, manuscript preparation;SCB data analyses and manuscript review, and MBR per-forming experiments; JC Luminex data analysis and inter-pretation. PK and HSJ data interpretation; ... Hasan S Jafri1 and Octavio Ramilo*1Address: 1Department of Pediatrics, Division of Pediatric Infectious Diseases, University of Texas Southwestern Medical Center at Dallas, Texas, USA,...
- 5
- 357
- 0
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
... in acute renal injury: ca ira. Curr OpinPharmacol 2006, 6(2):176-183.12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K,Ishida H, Shimizu T, Kangawa K, et al: Monolayered ... oflineage-restricted RoSH stem cell lines. Journal of molecular signaling2007,2:9.35. Thomas PD, Campbell MJ, Kejariwal A, Mi H, Karlak B, Daverman R,Diemer K, Muruganujan A, Narechania A: PANTHER: ... & nucleic acid metabolic processprimary metabolic processamino acid transportsulfur metabolic processorganelle organizationmitochondrion organizationperoxisomal transportcellular amino...
- 10
- 343
- 0
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... as follows: Periostin(forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA-CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC-GATTTCCCGC ... Y, Ogawa I, Kitagawa M, Kitajima S, Hatano H,Tilakaratne WM, Miyauchi M, Takata T: Periostin is frequentlySun et al . Journal of Translational Medicine 2011, 9:99http://www.translational-medicine.com/content/9/1/99Page ... Ogawa I, Kitajima S, Kitagawa M, Kawai H, Gaffney PM, Miyauchi M,Takata T: Periostin promotes invasion and anchorage-independentgrowth in the metastatic process of head and neck cancer. Cancer...
- 10
- 362
- 0
Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx
... equivalently η) as adjustable parameters. Again, a good match between experimental and theoretical data will demonstrate that the theoretical model is reliable and valid. The parameters for ... theoretical model that are needed to generate data (and thus compare with experimental data) are provided in Table 1. As can be seen from these data, these parameters include values for c that range ... to make it more adaptive and capable of producing data that are compatible with the experimental results. If the film has a thickness larger than two times the mean free path and a measured...
- 26
- 376
- 0
Báo cáo sinh học: "Hitching a lift hydrodynamically - in swimming, flying and cycling" ppsx
... further back in a formation had heart ratesaround 13% lower than birds flying alone; the leader of theformation had about the same wing beat frequency as a solitary bird, but birds further back ... traveling at 3.8m/sec in the stern wave had heart rates 20% lower thanwhen they swam at 2.9 m/sec well clear of the waves. (Nosatisfactory record could be obtained of heart rates wellclear of ... observations of the feetshowed that the rear duckling was paddling less vigorouslythan the leading one [4].It has been argued that fish in a school may be able tobenefit from each other’s wakes...
- 3
- 284
- 0
Báo cáo sinh học: " Q&A: What did Charles Darwin prove" ppsx
... Question & AnswerQQ&&AA:: WWhhaatt ddiidd CChhaarrlleess DDaarrwwiinn pprroovvee??Paul HarveyIItt iiss oofftteenn ssaaiidd tthhaatt DDaarrwwiinn’’sstthheeoorryy ooff nnaattuurraall ... ancestral tree species.SSoo hhee wwaassnn’’tt aann eexxppeerriimmeennttaallbbiioollooggiisstt??Yes he was that too, and moreover hewas a remarkable one. There is nodoubt that some people have ... that a higherproportion of tree species comparedwith other plants in Great Britain havemale and female flower structures onseparate plants. But he went furtherand showed that this pattern...
- 3
- 279
- 0
Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf
... 88::23Question & AnswerQQ&&AA:: GGeenneettiicc aannaallyyssiiss ooff qquuaannttiittaattiivvee ttrraaiittssTrudy FC MackayWWhhaatt aarree qquuaannttiittaattiivvee ttrraaiittss??Quantitative, ... molecularpolymorphisms.WWhhiicchh iiss bbeetttteerr,, lliinnkkaaggee mmaappppiinnggoorr aassssoocciiaattiioonn mmaappppiinngg??Both methods have advantages anddisadvantages. Linkage mapping,particularly ... small to large: the largeeffects segregate as Mendelianvariants, while the small effectssegregate as quantitative geneticvariation. For example, human heightis a classic quantitative trait,...
- 5
- 361
- 0
Từ khóa: báo cáo sinh học phân tửbáo cáo sinh học 2015bao cao sinh hoc 11 bai 26bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tínhchuyên đề báo cáo sinh họcbáo cáo sinh học thptbài báo cáo sinh học thực vậtbáo cáo khoa học sinh họctrạng thái hiện sinh báo cáo khoa họcbáo cáo sinh thái họcbáo cáo trường học thân thiện học sinh tích cựcmẫu báo cáo trường học thân thiện học sinh tích cựcbáo cáo trường học thân thiện học sinh tích cực tiểu họcbáo cáo trường học thân thiện học sinh tích cực violetbáo cáo trường học thân thiện học sinh tích cực 2013chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ