Báo cáo y học: " IL-1β induces murine airway 5-HT2A receptor hyperresponsiveness via a non-transcriptional " doc

Báo cáo y học: "Nicotine enhances murine airway contractile responses to kinin receptor agonists via activation of JNK- and PDE4-related intracellular pathways" pdf

Báo cáo y học: "Nicotine enhances murine airway contractile responses to kinin receptor agonists via activation of JNK- and PDE4-related intracellular pathways" pdf

... 77(1):17-28. 26. Aoki M, Kobayashi M, Ishikawa J, Saita Y, Terai Y, Takayama K, Miyata K, Yamada T: A novel phosphodiesterase type 4 inhibitor, YM976 (4-(3- chlorophenyl)-1, 7-diethylpyrido[2,3-d]pyrimidin-2(1H)-one), ... intracellular pathways Yuan Xu, Yaping Zhang * , Lars-Olaf Cardell Abstract Background: Nicotine plays an important role in cigarette-smoke-associated airway disease....
Ngày tải lên : 12/08/2014, 11:20
  • 17
  • 246
  • 0
Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

Báo cáo y học: "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV" ppsx

... 642:CCTGATAGCGGCGGACCCCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACAGAGCACAACCCTCCTCCTCTGCCAGGGAGAACGACGAAGAAGAGGCGGC 745 C FS type 1 643:CCTGATAGCGGCGGACCTCTCATTGACCTTCTCACAGAGGACCCCCC-GCCGTACGGAGCACAACCTTCCTCCTCTGCCAGGGAGAACAATGAAGAAGAGGCGGC 746 C FS type ... 204 ******************************************************************** Contaminant 205:ACGACTGGGATGAGACTGGACTCGGGTGTCGCACTCCCGGGGGAAAAAAAAG...
Ngày tải lên : 13/08/2014, 01:20
  • 7
  • 349
  • 0
Báo cáo y học: "Epstein–Barr virus and rheumatoid arthritis: is there a link''''" docx

Báo cáo y học: "Epstein–Barr virus and rheumatoid arthritis: is there a link''''" docx

... Kantakamalakul W, Chongkolwatana C, Naksawat P, Muangsom- boon S, Sukpanichnant S, Chongvisal S, Metheetrairat C, Kosi- tanont U, Puthavathana P: Specific IgA antibody to Epstein-Barr viral capsid ... 1 induces B cell lymphoma in transgenic mice. Proc Natl Acad Sci USA 1998, 95:11963-11968. 110. Yamazaki M, Kitamura R, Kusano S, Eda H, Sato S, Okawa-Takat- suji M, Aotsuka S, Yanagi K: Eleva...
Ngày tải lên : 09/08/2014, 07:20
  • 7
  • 346
  • 0
Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

... Chung SA, Ferreira RC, Pant PV, Ballinger DG, Kosoy R, Demirci FY, Kamboh MI, Kao AH, Tian C, Gunnarsson I, Bengtsson AA, Rantapaa-Dahlqvist S, Petri M, Manzi S, Seldin MF, Ronnblom L, Syvanen AC, ... Suarez-Gestal M, Calaza M, Pullmann R, Ros JO, Sebastiani GD, Ruzickova S, Santos MJ, Papasteriades C, Marchini M, Skopouli FN, Saurez A, Blanco FJ, D’Alfonso S, Bijl M, Carreira P, Migliaresi...
Ngày tải lên : 09/08/2014, 14:22
  • 2
  • 222
  • 0
Báo cáo y học: " Postconditioning inhibits myocardial apoptosis during prolonged reperfusion via a JAK2-STAT3Bcl-2 pathway" ppsx

Báo cáo y học: " Postconditioning inhibits myocardial apoptosis during prolonged reperfusion via a JAK2-STAT3Bcl-2 pathway" ppsx

... indicated that PostC may afford a persistent anti- apoptotic effect via a JAK2-STAT3-Bcl-2 pathway. Activation of the PI3K/Akt pathway prevents cardiac myocyte apoptosis and protects the myocardium ... phosphatidylinositol 3-kinase/Akt signaling and anti-inflammatory action in vivo. J Pharmacol Exp Ther 2009, 330:440-448. 21. Takahama H, Minamino T, Hirata A, Ogai A, Asanuma H, Fujita...
Ngày tải lên : 10/08/2014, 10:20
  • 8
  • 147
  • 0
Báo cáo y học: "Susceptibilities of medaka (Oryzias latipes) cell lines to a betanodavirus" docx

Báo cáo y học: "Susceptibilities of medaka (Oryzias latipes) cell lines to a betanodavirus" docx

... properly cited. Research Susceptibilities of medaka ( Oryzias latipes ) cell lines to a betanodavirus Kei Adachi, Kosuke Sumiyoshi, Ryo Ariyasu, Kasumi Yamashita, Kosuke Zenke and Yasushi Okinaka* Abstract Background: ... Kinoshita M, Murata K, Naruse K, Tanaka M: Medaka; Biology, Management, and Experimental Protocols Wiley-Blackwell, Iowa. 2009. 20. Taniguchi Y, Takeda S, Furutani-Seik...
Ngày tải lên : 12/08/2014, 04:20
  • 7
  • 199
  • 0
Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx

Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx

... forward 5'-ACA GGT GCC AGA CAA ACC TC-3', reverse 5'-TTC CAG CTG TGA CAC CTC AG-3'; CD32 forward 5'-TTC AAG GCC AAC AAC AAT GA-3', reverse 5'-GGA GAA GGT GGG ATC CAA ... reverse 5'-AGC AGG AGA AGC ACA TCA GC-3'; and IFI44 forward 5'-CTG GGG CTG AGT GAG AAA GA-3', reverse 5'-AGC GAT GGG GAA TCA ATG TA-3'; CXCL9 forward 5'-TG...
Ngày tải lên : 12/08/2014, 12:20
  • 12
  • 200
  • 0
Báo cáo y học: "Treatment of hypophosphatemia in the intensive care unit: a review" doc

Báo cáo y học: "Treatment of hypophosphatemia in the intensive care unit: a review" doc

... delivery Cardiovascular Decreased myocardial contractility Acute heart failure Increased inotropic requirement Arrhythmia Ventricular tachycardia Supraventricular tachycardia Premature beats Hematologic Hemolysis Leukocyte ... J, Pollack S, Bhat P, Ahuja T, Patel A, Singhal PC: Laboratory abnormalities in patients with bacterial pneumonia. Chest 1997, 111:595-600. 58. Vaidyanathan D, Venkate...
Ngày tải lên : 13/08/2014, 21:21
  • 8
  • 445
  • 0
Tài liệu Báo cáo Y học: Convulxin induces platelet shape change through myosin light chain kinase and Rho kinase ppt

Tài liệu Báo cáo Y học: Convulxin induces platelet shape change through myosin light chain kinase and Rho kinase ppt

... antagonists, Naphthalenesulfonamide derivatives. Mol. Pharmacol. 20, 571–578. 20. Takayasu, M., Suzuki, Y. , Shibuya, M., Asano, T., Kanamori, M., Okada, T., Kageyama, N. & Hidaka, H. (1986) ... Experimental Medicine and Pathology, Universita ´ La Sapienza, Viale Regina Elena 324, 00161 Rome, Italy. Fax: + 39 064452955, Tel.: + 39 064454820, E-mail: pierpaolo.gazzaniga@uniroma1.it Abbrev...
Ngày tải lên : 21/02/2014, 01:21
  • 7
  • 392
  • 0
Từ khóa: