Báo cáo khoa học: "Experimental Copper Deficiency, Chromium Deficiency and Additional Molybdenum Supplementation in Goats – Pathological Findings" doc

... of the sole Glyco_18 domain, the C-terminal tail of C. gigas CLPs may not noticeably contribute to the structure and the function of these proteins. Interestingly, Cg-Clp1 and Cg-Clp2 C-terminal ... Oyster chitinase-like proteins FEBS Journal 274 (2007) 36463654 ê 2007 The Authors Journal compilation ª 2007 FEBS 3651 Characterization of chitinase-like protei...

Ngày tải lên: 19/02/2014, 00:20

... Pr(VI,V2) = L where L = dim(V1) = dim(V2) 240 A Pattern Matching Method for Finding Noun and Proper Noun Translations from Noisy Parallel Corpora Pascale Fung Computer Science Department ... present a pattern matching method for compiling a bilingual lexicon of nouns and proper nouns from unaligned, noisy paral- lel texts of Asian/Indo-Euro...

Ngày tải lên: 20/02/2014, 22:20

... inhibitor directly and potently inhibits acti- vated hepatocyte growth factor activator. J Thromb Haemost 5, 1477–1485. 23 Suzuki K (2010) Hepatocyte growth factor activator (HGFA) : its regulation ... lability in serine protease active sites: struc- tures of hepatocyte growth factor activator (HGFA) alone and with the inhibitory domain from HGFA inhibitor-1B...

Ngày tải lên: 15/03/2014, 11:20

... 5Â-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3Â and 5Â-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3Â, and 5Â-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3Â and 5Â-CTAGAGTTAACCCGG GATATCTTTATCGTC ... insertion of < /b> the annealed fragment of < /b> the synthesized oligonucleotides, 5Â-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGC...

Ngày tải lên: 16/03/2014, 05:20

... Stimulation of SSTR2A with octreotide induced long-lasting sequestration of the intact ligand into early endosomes. Here, we investigated the intracellular trafficking of SSTR3 and the processing of internalized ... Distinct agonist-mediated endocyto- sis of cloned rat somatostatin receptor subtypes expressed in insulinoma cells. J Neuroendocrinol 9, 741–751. 21 Lucius R &am...

Ngày tải lên: 16/03/2014, 06:20

... contributions to the understanding of the effects of these mutations on the clinical symptoms of patients carrying cardiomyopathic Tms. Experimental procedures Construction of expression plasmids and site-directed mutagenesis The ... stability of the protein as a whole, rather than on the position of the mutation in the polypeptide chain, as demonstrate...

Ngày tải lên: 16/03/2014, 18:20

... arrange- ment of mitochondria in the cells, in the changes in the kinetics of regulation of mitochondrial respiration by exogenous ADP and ATP, and in the direct channelling of endogenous ADP and ATP ... disorganization of the regular intracellular mitochondrial arrangement, calcium induced changes in the kinetics of regulation of the resp...

Ngày tải lên: 16/03/2014, 22:20

... Biochem. 27 0) Ó FEBS 2003 Relationships between the ethanol utilization ( alc ) pathway and unrelated catabolic pathways in Aspergillus nidulans Michel Flipphi, Janina Kocialkowska and Be ´ atrice ... with either ethylamine or L -threonine as the nitrogen source (results not shown). Catabolism of L -proline and L -arginine does not lead to induction of...

Ngày tải lên: 17/03/2014, 10:20

... ê 2007 FEBS Differential susceptibility of Plasmodium falciparum versus yeast and mammalian enolases to dissociation into active monomers Ipsita Pal-Bhowmick, Sadagopan Krishnan and Gotam K. ... report successful dissociation of dimeric enolases from Plas- modium falciparum, yeast and rabbit muscle into active and isolatable monomers. Dimeric...

Ngày tải lên: 23/03/2014, 09:20

... [pULCTab] containing the penDE gene of A. nidulans without and with induction (note the formation of the 40-kDa protein and the lack of processing to the 29-kDa and 11-kDa subunits) in lane 4; lane 5, ... Biotecnologı ´ ade Leo ´ n INBIOTEC, Parque Cientı ´ fico de Leo ´ n, Spain The isopenicillin N acyltransferases (IATs) of Aspergillus nidulans...

Ngày tải lên: 31/03/2014, 01:20

... house Degree of taking instructions from owner Đ Foot disinfectant at the entrance of the building Frequency of renewing the disinfectant ∥ Wearing separated boots at each building On the farm Off ... experimentally in- oculated with avian influenza viruses of low and high pathogenicity. Avian Dis 1997, 41, 125-136. 12. Naeem K, Naurin M, Rashid S, Bano S....

Ngày tải lên: 07/08/2014, 20:23

... involved in this response. Growth response to thinning was very strong in the interval from 6 to 9 yr after thinning, and declined in the period 9-12 yr after thinning. ... dbh but also the interaction between Original article Growth response of holm oak (Quercus ilex L) to commercial thinning in the Montseny mountains...

Ngày tải lên: 08/08/2014, 23:22

... pour objet d’étudier, en conditions semi-contrôlées, la réponse à l’éclairement de l assimilation nette foliaire et de la croissance de jeunes plants de dix espèces d arbres ... foliaire de jeunes plants de dix arbres de la forêt guyanaise, cultivés à cinq niveaux d’éclairement Têtè Sévérien Barigah Pascal Imbert a Roland...

Ngày tải lên: 08/08/2014, 23:22

... traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test J.L. CAMPO Carmen RODRIGUEZ Departamento de Genetica Cuantitativa ... programs, even though the advantages of minimal record maintenance and animal handling increase its attraction. On the other hand, the arbitrary culling le...

Ngày tải lên: 09/08/2014, 22:22

... vet. scand. 2001, 42, 311-321. Acta vet. scand. vol. 42 no. 3, 2001 Experimental Copper Deficiency, Chromium Deficiency and Additional Molybdenum Supplementation in Goats – Pathological Findings ... gran- ules and a diminished basophilic staining reac- tion. The endocrine islets of the goats in the control group and groups 1 and 2 contained 30% glucagon an...

Ngày tải lên: 12/08/2014, 15:20