Báo cáo khoa học: "Calcification of the Intervertebral Discs and Curvature of the Radius and Ulna: A Radiographic Survey of Finnish Miniature" potx

Báo cáo khoa học: "Calcification of the Intervertebral Discs and Curvature of the Radius and Ulna: A Radiographic Survey of Finnish Miniature" potx

Báo cáo khoa học: "Calcification of the Intervertebral Discs and Curvature of the Radius and Ulna: A Radiographic Survey of Finnish Miniature" potx

... 2001 Calcification of the Intervertebral Discs and Curvature of the Radius and Ulna: A Radiographic Survey of Finnish Miniature Dachshunds By A. Lappalainen, M. Norrgård, K. Alm, M. Snellman and ... 2001 Lappalainen A, Norrgård M, Alm K, Snellman M. Laitinen O: Calcification of the intervertebral discs and curvature of the radius and ulna...

Ngày tải lên: 12/08/2014, 15:20

8 304 0
Báo cáo khoa học: " Intraoperative radiotherapy (IORT) combined with external beam radiotherapy (EBRT) for soft-tissue sarcomas – a retrospective evaluation of the Homburg experience in the years 1995–2007" pdf

Báo cáo khoa học: " Intraoperative radiotherapy (IORT) combined with external beam radiotherapy (EBRT) for soft-tissue sarcomas – a retrospective evaluation of the Homburg experience in the years 1995–2007" pdf

... planning of EBRT later. X-rays were taken nor- mally in anterior and lateral direction. The patient was transferred to the radiotherapy room under anaesthesia, and radiotherapy was performed there ... evaluation of the patients' records, col- lection of the data, letters to the patients and the referring doctors, and the entry of the data to the databank...

Ngày tải lên: 09/08/2014, 10:20

6 334 0
báo cáo khoa học: " Part II, Provider perspectives: should patients be activated to request evidence-based medicine? a qualitative study of the VA project to implement diuretics (VAPID)" potx

báo cáo khoa học: " Part II, Provider perspectives: should patients be activated to request evidence-based medicine? a qualitative study of the VA project to implement diuretics (VAPID)" potx

... manuscript. MBW assisted with transcription and qualitative analysis and reviewed a draft of the manuscript. MVW and AJC contributed to the design of the study and reviewing and revising the manuscript. ... it was a number that I probably wasn’t awareof becausemaybetheywerefinethedayI saw them and it did change my plan, you know, after seeing that.’ The intervent...

Ngày tải lên: 10/08/2014, 10:22

12 495 0
Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx

Báo cáo khoa học: "Within crown variation in hydraulic architecture in beech (Fagus sylvatica L): evidence for a stomatal control of xylem embolism" docx

... was measured when flow became in a steady state and K branch was calculated as the ratio between F and P: K = F / P. The LSC of the branch was calculated as the ratio be- tween K branch and the leaf ... calculated the fraction of inci- dent irradiance as the ratio between the irradiance mea- sured at a given place and irradiance above canopy. We completed these...

Ngày tải lên: 08/08/2014, 14:20

10 329 0
Báo cáo khoa học: "Gemcitabine/cisplatin versus 5-fluorouracil/ mitomycin C chemoradiotherapy in locally advanced pancreatic cancer: a retrospective analysis of 93 patients" pptx

Báo cáo khoa học: "Gemcitabine/cisplatin versus 5-fluorouracil/ mitomycin C chemoradiotherapy in locally advanced pancreatic cancer: a retrospective analysis of 93 patients" pptx

... both arms, 91% of the patients had an ECOG performance status of at least 2, respectively. All patients had ductal adenocarcinoma of the pancr eas as diagnosed by biopsy or laparoscopically during ... for the adjuvant chemotherapy and prevented maintenance chemotherapy. Commonly, the combination of a fluoropy rimidine with radiotherapy is regarded to be the standard of...

Ngày tải lên: 09/08/2014, 09:20

8 438 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... 3¢-RACE Zf3¢stat6-F2 CGGTAGTCAGGAAATCAATGCC 3¢-RACE Zf5¢stat6-R1 CCATGTCTGCAGATGGTCGAGG 5¢-RACE Zf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACE Zf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial...

Ngày tải lên: 16/02/2014, 09:20

20 690 0
Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

Tài liệu Báo cáo khoa học: Identification, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 710–728 RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778 Full-length sequencing of RpCAbr RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAbrR2 AGA GCA GCA GAC CTT ACG 706–723 RpCAbrR3 ... 706–723 RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–483 Probe amplification for FISH RpCAbrF TAC AAG GAT GCC ATT AGC 613–630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822–839 RpCAtrFp...

Ngày tải lên: 18/02/2014, 16:20

14 591 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA HSP70 TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT HSP23 ... kinase complex-associated protein AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG Non-selenium glutathione peroxidase CAATGAACAAAAAAGTCGCAACA GGGATGGAGGGTAAGACCATACA Gl...

Ngày tải lên: 18/02/2014, 16:20

11 571 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt

... nitrocellulose filters, as described in the Materials and methods. (A) Western blot- ting. The filter was assayed using anti-eEF 1A mAb, as described in the Materials and methods. The position of the eEF 1A protein was ... rinsed and then exposed to Omat XAR Kodak film, as described in the Materials and methods. The same samples were used for Western blotting analysis p...

Ngày tải lên: 21/02/2014, 00:20

12 552 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... animal glycoconjugate. They act as an important component of the ligands recognized by the lectins. Recognition can be affected by specific structural variations and modifications of sialic acids and ... contain 4-O-Ac-NeuAc [43], and rabbit erythrocytes, which contain 9-O-Ac-NeuAc [41], showed maximum haemagglutination. On the other hand, human blood cells A, B and O [44,45]...

Ngày tải lên: 21/02/2014, 00:20

8 617 0
Từ khóa:
w