Báo cáo y học: " Eosinophil and T cell markers predict functional decline in COPD patients" ppsx
Báo cáo y học: " Eosinophil and T cell markers predict functional decline in COPD patients" ppsx
... has indicated that eosinophils[1] and T lym- phocytes[2,3] are important determinants of disease sta- bility in COPD patients. Given these studies, we sought to determine if eosinophil or T cell ... predict subsequent decline. Recent studies indicate that T lymphocytes and eosinophils are important determinants of disease stability in COPD. We therefore measured cytoki...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: " Correction: Model-based parametric study of frontostriatal abnormalities in schizophrenia patients" ppsx
... Correction: Model-based parametric study of frontostriatal abnormalities in schizophrenia patients. BMC Psychiatry 2010 10:93. Submit your next manuscript to BioMed Central and take full advantage ... Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit Tanaka BMC Psychiatry 2010, 10:93 http://www.biomedcentral.com/1471-24...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Characteristics of T-cell large granular lymphocyte proliferations associated with neutropenia and inflammatory arthropathy" ppt
... cited. Abstract Introduction The purpose of this study was to analyze the data of patients with T- cell large granular lymphocyte (T- LGL) lymphocytosis associated with inflammatory arthropathy or with no ... patients, with and without arthritis. Further studies involving patients with RA and T- LGL proliferations may provide important data for a better under- standing of RA pathogene...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot
... On the other hand, the infiltration of T cells in the synovial tissue and the demonstration that there is auto- reactivity of T cells against type II collagen [10-13] suggest that a cell- mediated ... AGGCTCATCCATTATTCAAATAC BV14 GGGCTGGGCTTAAGGCAGATCTAC BV15 CAGGCACAGGCTAAATTCTCCCTG BV16 GCCTGCAGAACTGGAGGATTCTGG BV17 TCCTCTCACTGTGACATCGGCCCA BV18 CTGCTGAATTTCCCAAAGAGGGCC BV19 TCCTCT...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "Allergen-specific T cell quantity in blood is higher in allergic compared to nonallergic individuals" pptx
... IgE than allergen-specific B cells. The third important finding of the study is the simi- larity in allergen -specific Th cell quantity when analyzed at different time-points. This suggests that ... remarkably similar between time points. This implies that (1) cat/Timothy/ birch-specific Th cell counts are high in most but not all cat/Timothy/birch-allergic individuals and low in...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: " Depletion of T-cell intracellular antigen proteins promotes cell proliferation" potx
... ribonucleoproteins [5]. Consistently, both TIA proteins directly bind to RNA as well as to single- and double-stranded DNA [3-5]. It is tempting to speculate that TIA proteins could also interact with ... therefore, they could interact with basal transcription machinery and influence its activity. In addition, both pro- teins contain three RNA-binding motifs and are structurally close...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: " High Human T Cell Leukemia Virus Type-1(HTLV-1) Provirus Load in Patients with HTLV-1 Carriers Complicated with HTLV-1-unrelated disorders" docx
... patients, while the VL was at most 10 to 20% in general. On the other hand, patients co-infected with Table 1: The distribution of HTLV-1 SBH band status in samples without circulating ATL cells ... (6.3%)/16 asymp- tomatic healthy carriers, 8 (61.5%)/13 symptomatic carri- ers unrelated to HTLV-1 and 7(87.5%)/8 patients with lymphoma-type ATL without circulating ATL cells. On the other...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " Abnormalities of T cell signaling in systemic lupus erythematosus" pdf
... ecting the joints, skin, kidneys and brain and is characterized by autoantibody production by dysregulated B cells, target organ in ltration by in ammatory T cells and aberrant immune cell ... identifying predictive biomarkers and better therapeutic targets. T lymphocytes from SLE patients are unique in that they resemble naïve or somewhat anergic T cells in certai...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"
... unwilling to stop taking other medications for the treatment of OA Any other condition that, in the opinion of the investigator, would adversely affect the subject's ability to complete the ... Stitt LW. 1988. Validation study for WOMAC: health status in- strument for measuring clinically important patient relevant outcomes to antirheumatic drug therapy in patients with os- teo...
Ngày tải lên: 26/10/2012, 09:48
Báo cáo Y học: Production and chemiluminescent free radical reactions of glyoxal in lipid peroxidation of linoleic acid by the ligninolytic enzyme, manganese peroxidase pot
... paid to the oxidation of tartrate itself in these studies. This may be due to the understanding that the reactivity of tartrate is too low to be involved in the free radical reactions by Mn(III). ... effects of tartrate on the ABTS† 1 reduction was observed [38]. In contrast, the results obtained in the present study clearly indicate that tartrate itself was oxidized by MnP to produce...
Ngày tải lên: 24/03/2014, 04:21