Báo cáo y học: " KL-6 concentration in pulmonary epithelial lining fluid is a useful prognostic indicator in patients with acute respiratory distress syndrome" ppt

... epithelial lining fluid in acute respiratory distress syndrome. Am J Physiol Lung Cell Mol Physiol 2004, 286:L1088-L1094. 14. Kohno N, Awaya Y, Oyama T, Yamakido M, Akiyama M, Inoue Y, Yokoyama A, Hamada ... be a useful marker for pr edicting prog- nosis in ARDS patients. List of abbreviations ALI: acute lung injury; ANOVA: analysis of variance; ARDS: acute resp...

Ngày tải lên: 12/08/2014, 13:22

... can protect airway epithelium from HOCl mediated injury. These findings indicate another therapeutic benefit of hypertonic saline, apart from hydration of the airways, is through increasing airway antioxidant ... pathogen exposure and immune response is a contributing factor to the excessive inflammation seen in the CF airways. Along with increases in inflammatory cytokines in t...

Ngày tải lên: 12/08/2014, 11:22

... of single enzymes. Some examples are D -hydantoinase/N-carbamylase [7], b-galactosidase/galac- tokinase [8], citrate synthase/malate dehydrogenase [9], aminocyclopropane-carboxylic acid synthase/aminocyclo- propane-carboxylic ... 5¢-CTA CTCGAGCTACTTTTGCCTCTTGTA-3 FPPS C-terminal P3 5¢-TAGAG CCATGGCCTCAGCAGCAGTT¢-3¢ eAS N-terminal P4 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ eAS C-terminal P5 5¢-TA GG...

Ngày tải lên: 24/03/2014, 03:21

... period in h ospital [4-7]. Physiotherapy management of patients undergoing cor- onary artery bypass graft (CABG) surgery [ 8] and thor- acic surgery [9] has been examined in Australia and New Zealand. ... study shows a discrepancy in physiotherapy treatment accessibility to patients, depending on the weekday they are operated on. Sternal precautions are given routinely and cardiac...

Ngày tải lên: 10/08/2014, 09:22

... hemorrhage and coagulopathy in critical care patients carries significant morbidity and mortality, with increased incidence of respiratory failure and renal failure as well as multiple organ dysfunction. ... upper gastrointestinal bleeding. Despite adequate and aggressive resuscitation and medical management, he continues to hemorrhage. Administration of FVIIa is certainly warranted...

Ngày tải lên: 12/08/2014, 23:24

... 5'-GCG-TGT-GAA-CCA-GTG-GTA-GAT-C-3', and the Foxp3 probe was 5'-FAM-TCC-AGA-GAA-GCA-GCG- GAC-ACT-CAA-TG-TAMRA. Pre-developed Taqman assay reagent for human GAPDH was used as the internal con- trol. ... reduced TCR-induced Foxp3 mRNA (data not shown) and protein by either Western blot analysis (Fig. 5A) or by intracellular Foxp3 staining (Fig. 5B,C). Quantitative analysis of the...

Ngày tải lên: 13/08/2014, 05:22

... lethal triad in trauma patients [5]. In septic patients presenting with hypothermia, mortality is approximately twice as high as in patients without hypo- thermia [6]. This increased mortality has ... statistical analysis and MJS and JH coached the analysis and supervised the project. All authors contributed in the writing and the critical appraisal of the manuscript. All au...

Ngày tải lên: 13/08/2014, 20:22

... Severity Score (ISS) and organ injury according to Injury Scaling and Scoring System [9]. Patients& apos; status in admission was evaluated by ISS, admis- sion hematocrit, hemodynamic stability (SBP >90 ... Panayotis A Patsaouras - patsaourasp@yahoo.com; Michalis K Digalakis - cdigalaki@yahoo.gr * Corresponding author †Equal contributors Abstract Background: To evaluate the feasibilit...

Ngày tải lên: 13/08/2014, 23:20

... to radioresistance in nasopharyngeal carcinoma (NPC) and ORC cell lines [14,15], indicating that this molecule may affect the efficacy of radiotherapy. In this study, we investigated the clinical ... Hospital, Taoyuan 333, Taiwan. 4 Department of Otorhinolaryngology, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan. 5 Department of Pathology, Chang Gung Memorial Hospital, Taoyuan 333...

Ngày tải lên: 09/08/2014, 09:21

... by anthropometric measures and by single-frequency body impedance, and waist-to-hip ratio. Analysis of concordance between impedance and anthropometric measures and hazard ratios of achieving target temperature ... that the main limita- tion of this study is the small sample size and subsequent lack Table 3 Baseline characteristics of patients Patients included 27 Male, percentage (number...

Ngày tải lên: 13/08/2014, 11:22