Báo cáo y học: " KL-6 concentration in pulmonary epithelial lining fluid is a useful prognostic indicator in patients with acute respiratory distress syndrome" ppt

Báo cáo y học: " KL-6 concentration in pulmonary epithelial lining fluid is a useful prognostic indicator in patients with acute respiratory distress syndrome" ppt

Báo cáo y học: " KL-6 concentration in pulmonary epithelial lining fluid is a useful prognostic indicator in patients with acute respiratory distress syndrome" ppt

... epithelial lining fluid in acute respiratory distress syndrome. Am J Physiol Lung Cell Mol Physiol 2004, 286:L1088-L1094. 14. Kohno N, Awaya Y, Oyama T, Yamakido M, Akiyama M, Inoue Y, Yokoyama A, Hamada ... be a useful marker for pr edicting prog- nosis in ARDS patients. List of abbreviations ALI: acute lung injury; ANOVA: analysis of variance; ARDS: acute resp...

Ngày tải lên: 12/08/2014, 13:22

7 363 0
Báo cáo y học: " Hypertonic saline increases lung epithelial lining fluid glutathione and thiocyanate: two protective " pot

Báo cáo y học: " Hypertonic saline increases lung epithelial lining fluid glutathione and thiocyanate: two protective " pot

... can protect airway epithelium from HOCl mediated injury. These findings indicate another therapeutic benefit of hypertonic saline, apart from hydration of the airways, is through increasing airway antioxidant ... pathogen exposure and immune response is a contributing factor to the excessive inflammation seen in the CF airways. Along with increases in inflammatory cytokines in t...

Ngày tải lên: 12/08/2014, 11:22

10 337 0
Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

Báo cáo Y học: Fusion of farnesyldiphosphate synthase and epi-aristolochene synthase, a sesquiterpene cyclase involved in capsidiol biosynthesis in Nicotiana tabacum docx

... of single enzymes. Some examples are D -hydantoinase/N-carbamylase [7], b-galactosidase/galac- tokinase [8], citrate synthase/malate dehydrogenase [9], aminocyclopropane-carboxylic acid synthase/aminocyclo- propane-carboxylic ... 5¢-CTA CTCGAGCTACTTTTGCCTCTTGTA-3 FPPS C-terminal P3 5¢-TAGAG CCATGGCCTCAGCAGCAGTT¢-3¢ eAS N-terminal P4 5¢-CTACTCGAGTCAAATTTTGATGGAGTC-3¢ eAS C-terminal P5 5¢-TA GG...

Ngày tải lên: 24/03/2014, 03:21

8 410 0
Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot

Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot

... period in h ospital [4-7]. Physiotherapy management of patients undergoing cor- onary artery bypass graft (CABG) surgery [ 8] and thor- acic surgery [9] has been examined in Australia and New Zealand. ... study shows a discrepancy in physiotherapy treatment accessibility to patients, depending on the weekday they are operated on. Sternal precautions are given routinely and cardiac...

Ngày tải lên: 10/08/2014, 09:22

7 437 0
Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt

Báo cáo y học: " Pro/Con Debate: Does recombinant factor VIIa have a role to play in the treatment of patients with acute nontraumatic hemorrhage" ppt

... hemorrhage and coagulopathy in critical care patients carries significant morbidity and mortality, with increased incidence of respiratory failure and renal failure as well as multiple organ dysfunction. ... upper gastrointestinal bleeding. Despite adequate and aggressive resuscitation and medical management, he continues to hemorrhage. Administration of FVIIa is certainly warranted...

Ngày tải lên: 12/08/2014, 23:24

4 305 0
Báo cáo y học: "Endogenous TGF-β activation by reactive oxygen species is key to Foxp3 induction in TCR-stimulated and HIV-1-infected human CD4+CD25- T cells" docx

Báo cáo y học: "Endogenous TGF-β activation by reactive oxygen species is key to Foxp3 induction in TCR-stimulated and HIV-1-infected human CD4+CD25- T cells" docx

... 5'-GCG-TGT-GAA-CCA-GTG-GTA-GAT-C-3', and the Foxp3 probe was 5'-FAM-TCC-AGA-GAA-GCA-GCG- GAC-ACT-CAA-TG-TAMRA. Pre-developed Taqman assay reagent for human GAPDH was used as the internal con- trol. ... reduced TCR-induced Foxp3 mRNA (data not shown) and protein by either Western blot analysis (Fig. 5A) or by intracellular Foxp3 staining (Fig. 5B,C). Quantitative analysis of the...

Ngày tải lên: 13/08/2014, 05:22

16 250 0
Báo cáo y học: "Spontaneous hypothermia on intensive care unit admission is a predictor of unfavorable neurological outcome in patients after resuscitation: an observational cohort study" pptx

Báo cáo y học: "Spontaneous hypothermia on intensive care unit admission is a predictor of unfavorable neurological outcome in patients after resuscitation: an observational cohort study" pptx

... lethal triad in trauma patients [5]. In septic patients presenting with hypothermia, mortality is approximately twice as high as in patients without hypo- thermia [6]. This increased mortality has ... statistical analysis and MJS and JH coached the analysis and supervised the project. All authors contributed in the writing and the critical appraisal of the manuscript. All au...

Ngày tải lên: 13/08/2014, 20:22

5 407 0
Báo cáo y học: " Non-operative management of blunt abdominal trauma. Is it safe and feasible in a district general hospital?" doc

Báo cáo y học: " Non-operative management of blunt abdominal trauma. Is it safe and feasible in a district general hospital?" doc

... Severity Score (ISS) and organ injury according to Injury Scaling and Scoring System [9]. Patients& apos; status in admission was evaluated by ISS, admis- sion hematocrit, hemodynamic stability (SBP >90 ... Panayotis A Patsaouras - patsaourasp@yahoo.com; Michalis K Digalakis - cdigalaki@yahoo.gr * Corresponding author †Equal contributors Abstract Background: To evaluate the feasibilit...

Ngày tải lên: 13/08/2014, 23:20

6 435 0
Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt

Báo cáo khoa học: "GP96 is over-expressed in oral cavity cancer and is a poor prognostic indicator for patients receiving radiotherap" ppt

... to radioresistance in nasopharyngeal carcinoma (NPC) and ORC cell lines [14,15], indicating that this molecule may affect the efficacy of radiotherapy. In this study, we investigated the clinical ... Hospital, Taoyuan 333, Taiwan. 4 Department of Otorhinolaryngology, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan. 5 Department of Pathology, Chang Gung Memorial Hospital, Taoyuan 333...

Ngày tải lên: 09/08/2014, 09:21

24 275 0
Báo cáo y học: "The influence of body composition on therapeutic hypothermia: a prospective observational study of patients after cardiac arre" pot

Báo cáo y học: "The influence of body composition on therapeutic hypothermia: a prospective observational study of patients after cardiac arre" pot

... by anthropometric measures and by single-frequency body impedance, and waist-to-hip ratio. Analysis of concordance between impedance and anthropometric measures and hazard ratios of achieving target temperature ... that the main limita- tion of this study is the small sample size and subsequent lack Table 3 Baseline characteristics of patients Patients included 27 Male, percentage (number...

Ngày tải lên: 13/08/2014, 11:22

5 546 0
w