Báo cáo y học: " b-thymosins and interstitial lung disease: study of a scleroderma cohort with a one-year follow-up" potx
Báo cáo y học: "Preformulation and stability in biological fluids of the retrocyclin RC-101, a potential anti-HIV topical microbicide/; potx
... transition sepa-rately, and peak areas were manually tabulatedStatistical analysisHPLC data obtained from the preformulation studieswere expressed as the average percentage of the peakarea ... Billy W. Day and Dr. Manimalha Balasubramani atthe Genomics and Proteomics Core Laboratories at the University of Pittsburgh for the assistance provided for the MALDI-TOF MS analysis. LornaRabe ... LC-MS/MS analysis as described above. For each condition ana-lyzed, supernatant and cells, the LC-MS/MS chromato-gram was obtained. Data were analyzed by construction of mass chromatograms for each...
- 11
- 512
- 0
Báo cáo y học: " Liver and brain abscess caused by Aggregatibacter paraphrophilus in association with a large patent foramen ovale: a case report" pps
... 4:69http://www.jmedicalcasereports.com/content/4/1/69Page 3 of 4CAS E REP O R T Open AccessLiver and brain abscess caused byAggregatibacter paraphrophilus in association with a large patent foramen ovale: a case reportShaumya Ariyaratnam1, ... possibility of further para-doxical emboli and this is planned. Our patient was puton anti-coagulant and anticonvulsant therapy and a cra-nial MRI on day 137 has show n further improvement of the ... (former name Haemophilus paraphrophilus) is a normal commensal of the oral flora. It is a rare cause of hepatobiliary or intracerebral abscesses.Case presentation: We report a case of a 53-year-old...
- 4
- 327
- 0
Báo cáo y học: "Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach" ppsx
... Ste12pSTE2Rox1pSte12pRRPECER cgtgcattaagacaggctagtaTAAACGAGAAGAAGtatcctgctttgcaaTGAAACAATAGtatccgctaagaatttaagcaggccaacPAR cctg-agtaagacagcctagtacAAATGAAAAgAACCACActgctttacaataaaacaacggtacccactaagaattcaggcaggctgtc* ... TGAAACAATAGtatc-cgctaagaatttaagcaggccBAY tccacgcatggggattgctTGAAGAAaataggaagaaccg-gctgc TTCAACATGAAACAtcagtactatactgtcaactcctgtaggctPAR ctcctg-agtaagacagcctagtacAAATGAAAAgAACCACActgctttacaataaaacaacggtacc-cactaagaattcaggcaggctMIK ... ttctcgttcacttATTTCAAcTATTATTctaatcca gtttaataat CER gcaccgttaag-aacca tatCCAAGAATcaaaa-BAY PAR gcaccattaag-aacaactgtatCCAAGAAGcaaaa-MIK gtatcattagttaaaaagtgtacttaaggagcaaaag Upc2pMcm1pMATalpha2pMatalpha2p...
- 27
- 276
- 0
Báo cáo y học: " b-thymosins and interstitial lung disease: study of a scleroderma cohort with a one-year follow-up" potx
... 12:22http://respiratory-research.com/content/12/1/22Page 8 of 8RESEARCH Open Access b-thymosins and interstitial lung disease: study of a scleroderma cohort with a one-year follow-upMaria De Santis1, Rosanna Inzitari2, ... monocytes in the presence of glucocorticoids. Nat Med 1999, 5(12):1424-7.12. Badamchian M, Damavandy AA, Damavandy H, Wadhwa SD, Katz B,Goldstein AL: Identification and quantification of thymosin ... b-thymosins and interstitial lung disease: study of a scleroderma cohort with a one-year follow-up.Respiratory Research 2011 12:22.De Santis et al. Respiratory Research 2011, 12:22http://respiratory-research.com/content/12/1/22Page...
- 8
- 400
- 0
Báo cáo y học: " Angiogenesis in Interstitial Lung Diseases: a pathogenetic hallmark or a bystander?" potx
... 171:261-268.64. Hamada N, Kuwano K, Yamada M, Hagimoto N, Hiasa K, Egashira K,Nakashima N, Maeyama T, Yoshimi M, Nakanishi Y: Anti-vascularendothelial growth factor gene therapy attenuates lung injury and ... endothelial cells in an autocrine and paracrine way. Generation of reactive oxygen species and activation of kinase pathogenetic pathways converges and activates NF-κB and sets in motion a process ... 2002,196(2):220-227.55. Nakayama S, Mukae H, Ishii H, Kakugawa T, Sugiyama K, Sakamoto N,Fujii T, Kadota J, Kohno S: Comparison of BALF concentrations of ENA-78 and IP10 in patients with idiopathic pulmonaryfibrosis...
- 13
- 268
- 0
Báo cáo Y học: Production and chemiluminescent free radical reactions of glyoxal in lipid peroxidation of linoleic acid by the ligninolytic enzyme, manganese peroxidase pot
... peroxidase(MnP) and laccase (Lac), play a key role in generating freeradicals from lignin and oxidizable fungal metabolites suchas oxalate, glyoxylate, malonate, hydroquinones and arylalcohols. ... course of glyoxal production by MnP was analyzed asdescribed above after the reaction with and without linoleicacid in formate and tartrate buffers. EI/GC/MS analyses of authentic aldehydes and ... peroxidaseTakashi Watanabe1, Nobuaki Shirai2, Hitomi Okada1, Yoichi Honda1 and Masaaki Kuwahara11Laboratory of Biomass Conversion, Wood Research Institute, Kyoto University, Gokasho,...
- 9
- 459
- 0
Báo cáo y học: "Progress and Challenges in the Understanding of Chronic Urticaria" pptx
... the state of occupancy of the Fcereceptor by its natural ligand IgE. Horn and colleaguesproposed that an imbalance between FceR 1a occupancy and natural anti-FceR 1a antibodies may be implicated ... profile27or a mixture of activated Th1 and Th2 cells. Study on Releasability of Chronic UrticariaBasophilsHowever, 60% of patients with chronic urticaria lackingany detectable autoantibody ... normal donors, hoping toidentify a basophil abnormality that might distinguishpatients with idiopathic urticaria from patients with autoimmune urticaria. A basophil abnormality is of particular...
- 5
- 467
- 1
Báo cáo y học: "Smoking and nicotine exposure delay development of collagen-induced arthritis in mice" pptx
... [25] and TNFα was quantified using a standardELISA assay (R&D Systems, Minneapolis, MN, USA).Statistical analysisStatistical evaluation was made using the Mann–Whitney Utest, the chi-squared ... significantly more often than non-smokers [9]. Anal-ysis of patients with primary Sjögren's syndrome showed thatsmokers had a lower degree of focal inflammation in minor sal-ivary glands ... Intensity of inflammation was evaluated byserum IL-6 and TNF-α levels. Additionally, antibody response toCII (anti-CII) and citrullinated peptides (aCCP) was measured.Results Clinical evaluation of...
- 8
- 339
- 0
Báo cáo y học: " Recombination and base composition: the case of the highly self-fertilizing plant Arabidopsis thaliana" pdf
... filesAdditional data available with this article online, show thecodon bias and base composition in Arabidopsis thaliana(Additional data file 1). It lists all genes analyzed in our anal-ysis of base ... Mendelian segregation of alleles[73]. Assume that alternative GC and AT alleles at a site areneutral and that the ratio of GC:AT gametes from GC/AT het-erozygotes is k:k - 1. In a random-mating ... the A. thaliana genome, boththeoretically and by DNA sequence analysis. Our goal was totest for an effect of recombination on GC content and codonbias in A. thaliana, and to use models to examine...
- 9
- 408
- 0
Báo cáo y học: " Research and Policy, Stanford University School of" pdf
... African AmericansFigure 3Principal components analysis of three West and Central West African populations (Mandenka, Yoruba, and Bantu) and African Americans by using only African-origin genotypes ... Europeanancestry with a standard deviation of approximately 10%, and a range of near 0 to 65% [1], whereas another study based onancestry informative markers (AIMs) found an average of 17.7% European ancestry ... ancestry inour samples of African Americans is of African origin. A care-ful examination of the African component of ancestry in thePrincipal components analysis of Africans, U.S. Caucasians, and...
- 11
- 291
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ