Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx
... IFN-I are already in clinical trials [40], flow-cytometry analysis of CD64 expression may be a convenient and rapid approach for estimating IFN-I levels in SLE patients. Abbreviations ACR: American ... Grutzkau A: Sialic acid-binding Ig-like lectin 1 expression in inflammatory and resident monocytes is a potential biomarker for monitoring disease activity and success of...
Ngày tải lên: 12/08/2014, 12:20
... processing of procaspase-3, procaspase-6, and procaspase-7 by binding and blocking the activity of caspase-9. Increasing evidence demonstrated that IAPs are up regulated in many human tumor types ... digestion of DNase. Finally RNA was released from cup and stored in –70° C for use. Micro-array analysis For gene array analysis, 100 µg RNA was reversely transcripted in to cDNA...
Ngày tải lên: 02/11/2012, 11:17
... D14-reductase from bovine liver Rita Roberti 1 , Anna Maria Bennati 1 , Giovanni Galli 2 , Donatella Caruso 2 , Bruno Maras 3 , Cristina Aisa 4 , Tommaso Beccari 4 , Maria Agnese Della Fazia 4 and Giuseppe ... activity [25], a protein co- migrating in SDS/PAGE was revealed by amino-acid sequence a nalysis. The determined N-terminal s equence of the protein, APPQGSRAPLEFGGPLGAAALML, wa...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
... isolated from DpAR1. Table 1. Enzymatic activity of DpAR1 and DpAR2 recombinant pro- teins. Data are mean values (± SD) of triplicate assays. Substrate Enzymatic activity (UÆmg )1 protein) DpAR1 ... sequences of proteins within a closely related AKR family. Sequences aligned are DpAR1 and DpAR2, D. purpurea (this study); AAC23647, AAD32792, CAB88350 and AAC2346, Arabidopsis thaliana;M...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo y học: "tatin-induced expression of CD59 on vascular endothelium in hypoxia: a potential mechanism for the anti-inflammatory actions of statins in rheumatoid arthritis" pptx
... decay-accelerating factor expressionHypoxia increases atorvastatin-induced decay-accelerating factor expression. Analysis of decay-accelerating factor expression on human umbilical vein endothelial cells ... effects of DAF. Treatment of HUVEC Figure 5 Mechanisms involved in atorvastatin-induced decay-accelerating factor expressionMechanisms involved in atorvastatin-induced decay...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
... GTCAGCCAACTCGTCACAGTCC OPN Sense AGCCGTGGGAAGGACAGTTATG 472 62 29 NM_000582 Antisense GAGTTTCCATGAAGCCACAAAC IGF-I Sense GAGCCTGCGCAATGGAATAAAG 344 62 33 NM_000618 Antisense CCTGTCTCCACACACGAACTG IGF-II Sense ... The authors thank Professor David M Findlay (Department of Orthopaedics and Trauma, Royal Adelaide Hospital, Adelaide, Australia) for the kind use of his laboratory for the und...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "High synovial expression of the inhibitory FcγRIIb in rheumatoid arthritis" ppsx
... FcγRIII are low affinity receptors that predom- inantly bind IgG-ICs. Fc RI, FcγRIIa, FcγRIIIa and FcγRIIIb are activating receptors. Fc RI and FcγRIIIa consist of an α-chain with three and two ... regulation of the activating FcγRs in arthritic joints than in healthy joints. Augmented expression of activating FcγRs in RA synovia As no thorough analysis of the expression o...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Flow cytometry analysis of glucocorticoid receptor expression and binding in steroid-sensitive and steroid-resistant patients with systemic lupus erythematosus" pps
... Abnormal serological data, haematuria, proteinuria, red blood cell casts 60 18 13 22 F 0 Abnormal serological data, haematuria, proteinuria 60 14 8 23 F 25 Abnormal serological data, haematuria, ... GCs sensitivity assays. The validity of FCM analysis of intracellular staining for GR with GR-mAb and FITC-Dex probes was evaluated through comparison with western blot and radioligand bindin...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " The functional expression of extracellular calcium-sensing receptor in rat pulmonary artery smooth muscle cells" potx
... The CaSR is important in m aintaining and regulating mineral ion homeostasis. Increasing evidence has indicated that CaSR was functionally expressed in the cardiovascular system. Wang et al showed ... 8), indic ating that [Ca 2+ ] o -induced vasocons triction was at least partly mediated via activation of CaSR. CaSR activation-induced constriction of pulmonary artery rings is dependen...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "High nuclear expression of STAT3 is associated with unfavorable prognosis in diffuse large B-cell lymphoma" doc
... pathway, resulting in the resistance to ABT-869, a pr omising multi-targeted tyrosine kinase inhibitor [12]. STAT pathway also triggers the activity of receptor- a ssociated Janus kinase (JAK) family ... Institute; Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education); Beijing 100142, China Full list of author information is available at the end o...
Ngày tải lên: 10/08/2014, 21:23