báo cáo khoa học: " Arabidopsis thaliana outer ovule integument morphogenesis: Ectopic expression of KNAT1 reveals a compensation mechanism" docx

... expression. (A) Abaxial (dark blue) and adaxial (light blue) domains of the outer integ- ument. (B) Abaxial and adaxial domains of lateral organs of the shoot apical meristem (colour code as in (A) ). ... Access Research article Arabidopsis thaliana outer ovule integument morphogenesis: Ectopic expression of KNAT1 reveals a compensation mechanism Elisabeth T...

Ngày tải lên: 12/08/2014, 05:20

... Okamuro JK, Caster B, Villarroel R, Van Montagu M & Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proc Natl Acad Sci USA 94, 7076–7081. 34 ... M, Schmulling T & Heyl A (2008) Toward an interaction map of the two-component signaling pathway of Arabidopsis thaliana. J Proteome Res 7, 3649–3660. 43 Sparkes IA...

Ngày tải lên: 18/02/2014, 06:20

... protein (512 amino acids) has a calcu- lated mass of 58 134 Da and a pI of 8.71. Enzymatic characterization of CYP7 7A4 was carried out employ- ing microsomes from the yeast strain WAT11 trans- formed ... sequence of CYP7 7A4 (AT5g04660) was cloned by PCR from a DNA library of Arabidopsis ecotype Columbia-0. Primers 5¢-CCCCAGATCTATGTTTCCTCT AATCTC-3¢ and 5¢-GGGGGGTACCCTAAATC...

Ngày tải lên: 07/03/2014, 03:20

... Shvedova AA, Castranova V, Kisin ER, Schwegler- Berry D, Murray AR, Gandelsman VZ, Maynard A & Baron P (2003) Exposure to carbon nanotube material: assessment of nanotube cytotoxicity using human ... (Nepean, Canada); Alamar blue reagent from Biosource (Montreal, Canada); paraformal- dehyde (PFA) from BDH Laboratories (Poole, UK); glia-specific rabbit GFAP antibody (Z0334) from Doko Cy...

Ngày tải lên: 07/03/2014, 00:20

... Aziz MH, Reagan-Shaw SR, Nihal M, Mukhtar H & Ahmad N (2004) Sanguinarine causes cell cycle blockade and apoptosis of human prostate carci- noma cells via modulation of cyclin kinase inhibitor- cyclin-cyclin-dependent ... from the plant Sanguinaria canadensis, has been shown to have anti- microbial, anti-inflammatory, antioxidant, and anti- cancer activities [18–27]. It was reported to...

Ngày tải lên: 07/03/2014, 12:20

... 5¢-AGCTTGATCTGCGAGGTTGTCTG CTATCTCTTGA ATAGCAGACAACCTCGCAGAG-3¢; HMGN2-shRNA-2: sense, 5¢-GATCCA AATGGAGATGC CAAAACATTCAAGAGATGTTTTGGCATCTCCATTT TCA-3¢;antisense, 5¢-AGCTTGAAAATGGAGATGCCAA AACATCTCTTGAATGTTTTGGCATCTCCATTTG-3¢). Additional ... 5¢-AGCTTT GAAAACG TATATGATACCAACAGTAATCTCTTGAATTACTGT TGGTATCATATACGGG-3¢; negative shRNA: sense, 5¢-G ATCCGACTTCATAAGGCGACTGCT TCAAGACGGC ATGCGCCTTATGA...

Ngày tải lên: 22/03/2014, 16:20

... 5¢-CAGTTAACAAGCATTCAGCCAAC- 3¢; SHP: forward primer: 5¢-AGCTATGTGCACCTCATC GCACCTGC-3¢, reverse primer: 5¢-CAAGCAGGCTGGT CGGAATGGACTTG-3¢; and b-actin: forward primer: 5¢- GACTACCTCATGAAGATC-3¢, ... reverse primer: 5¢-ACG GTGGTCTCCATGCGACG-3¢; HBV core: forward primer: 5¢-ATGCAACTTTTTCACCTCTGC-3¢, reverse primer: 5¢-CTGAAGGAAAGAAGTCAGAAG-3¢; FXRa: forward primer: 5¢-GCCTGTAACAAAGAAGCCCC-3¢, r...

Ngày tải lên: 22/03/2014, 21:21

... Good perioperative anesthesia management and a laparotomy- based surgical approach - d ue to the patient’ sunstable condition - enabled tumor removal and, within a few days, complete reversal of clinical ... presentation The patient was a 31-year-old male, with no known drug allergies. Pulmonary emphysema and an esophageal fistula had been diagnosed 7 years earlier. The patient had a...

Ngày tải lên: 09/08/2014, 01:24

... with an unusual presentation simulating a testicular neoplasm. Case presentation A 25-year-old Caucasian m an went to a general practi- tioner because of right testicular swelling and was trea- ted ... testicle was enlarged and painful on palpation, and the skin of the right hemiscrotal region was red and warm. Pain increased gradually and worsened slightly with time, but this type...

Ngày tải lên: 09/08/2014, 01:25

... the survival data we also analyzed the animals' clinical status. We found that imatinib treatment in both early and late treatment arms also attenuated radiation- related clinical adverse ... H, Nakagawa K, Nakamura N, Koyanagi H, Tago M, Igaki H, Shiraishi K, Sasano N, Ohtomo K: Exceptionally high incidence of symptomatic grade 2-5 radiation pneumonitis after stere- otactic radiation...

Ngày tải lên: 09/08/2014, 10:20