báo cáo khoa học: " TaMSH7: A cereal mismatch repair gene that affects fertility in transgenic barley (Hordeum vulgare L )" pot
báo cáo khoa học: " TaMSH7: A cereal mismatch repair gene that affects fertility in transgenic barley (Hordeum vulgare L.)" pot
... AACCACTCGAATAAGTTCTCAGTATCTATGAATGGTAAGCATATTGGAGCAGCTGCTACACTGTTTCCAGAAC N3BT3Ad (25) AACCACTCCAATAAGTTCTCAGTATCTATGAACAGTAAGAATATTGGAGCACCTGCTACACTGTTTCCGGAAC CS D (25) AACCACTCCAATAAGTTCTCAGTATCTATGAACAGTAAGAATATTGGAGCACCTGCTACACTGTTTCCGGAAC Tt ... AACCACTTGAATAAGTTCTCAGTATCTATGAATGGTAAGCATATTGGAGCACCTGCTACACTGTTTCCGGAAC CS A (25) AACCACTTGAATAAGTTCTCAGTATCTATGAATGGTAAGCATATTGGAGCACCT...
Ngày tải lên: 12/08/2014, 05:20
báo cáo khoa học: "SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus" doc
... Table 5. Change in fibre SCW thickness, cell wall area, fibre cell area and lumen area of Eucalyptus sectors overexpressing Arabidopsis SND2. Sample Cell wall thickness (%) Cell wall area ... cell wall area in SND2-overexpressing sectors was close to significant (P = 0.066), it is reasonable to suggest that the increase in fibre cell area was mainly due to a cell wall area in...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: "Detection of DNA mismatch repair proteins in fresh human blood lymphocytes - towards a novel method for hereditary non-polyposis colorectal cancer (Lynch syndrome) screening" doc
... as DNA sequencing and microsatellite analysis are accurate, but are more expensive, take longer to do, and are mainly available at commercial laboratories. Also, DNA sequencing and microsatellite ... protein in the denominator. Results To develop an immunoassay that is accurate, we screened a number of commercially available monoclonal and poly- clonal antibodies (Table 1) using western...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo khoa học: "cdec: A Decoder, Alignment, and Learning Framework for Finite-State and Context-Free Translation Models" potx
... development, including minimum risk train- ing using a linearly decomposable approximation of BLEU (Li and Eisner, 2009), and MIRA train- ing (Chiang et al., 2009). All of these will be made publicly ... 2 a small little house shell Goal 010 100 101 110 a small little 1 a 1 house 1 shell 1 little 1 small 1 house 1 shell 1 little 1 small Figure 3: Example unrescored translation hypergr...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... predicted transmembrane localization of FLPLLILGSLLMTPPVI(1–17) fragment] it is conceivable that the N-terminal apolar helix favors transmembrane localization while the C-terminal amphi- philic helix, ... recombinants were able to reduce the life span of infected insects. The tropical ant Paraponera clavata is a predator of small animals such as insect larvae. Its venom contains a poten...
Ngày tải lên: 30/03/2014, 13:20
báo cáo khoa học: "Turning a blind eye: the mobilization of radiology services in resource-poor regions" pot
... duncansr@post.harvard.edu 1 Nyaya Health, Bayalpata Hospital, Ridikot VDC, Achham, Nepal Full list of author information is available at the end of the article Maru et al. Globalization and Health ... our clinical services. All protocols are publicly available via the Nyaya Health wiki [14] and blog [8]. Subsequently, in 2010, Nyaya Health initiated an X-Ray program with a WHIS-RAD machin...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo khoa học: The pivotal regulator GlnB of Escherichia coli is engaged in subtle and context-dependent control potx
... glutamate, aspartate, asparagine, l- alanine, and d-alanine. In Escherichia coli and Salmo- nella. Cellular and Molecular Biology (Neidhardt FC, Curtiss R III, Ingraham JL, Lin ECC, Low KB, Maga- sanik ... dual, bicyclic cascade (Fig. 1). GS can be both adenylylated and deadenylylated by the bifunctional enzyme ade- nylyltransferase (ATase) [22]; the N-terminal domain of ATase carries the...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: NrpRII mediates contacts between NrpRI and general transcription factors in the archaeon ¨ Methanosarcina mazei Go1 pot
... amplified using primers (Mm 2184 His.for 5¢-CCAAATACA GGATCCATGGA- ATCTAC and Mm 2184 His.rev 5¢-GA GAATTCATTT- AATAAAGAAGTCCTAAG) that added flanking BamHI and EcoRI sites and facilitated cloning the ... 5¢-GGTTGA CATATGAGCGAATC ⁄ Mm1028 His. rev 5¢-G AAGCTTCTTATAAAAGCCCC; and Mm 1772 His.for 5 ¢-GGTGATAT CATATGGTAGAAGTCG ⁄ Mm 1772 His.rev 5¢-GAAGA AAGCTTTAGAGGATAATCTCG) add- ing flanking Nde...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: Cholesterol and its anionic derivatives inhibit 5-lipoxygenase activation in polymorphonuclear leukocytes and MonoMac6 cells pot
... 3¢-phosphoadenosine-5-phos- phosulfate (PAPS) induced a 300-fold increase in platelet CS content. HDL and specifically apoA-I sta- bilized and maintained the level of platelet SULT2B1b mRNA [48]. We speculate that platelets ... 551 Cholesterol and its anionic derivatives inhibit 5-lipoxygenase activation in polymorphonuclear leukocytes and MonoMac6 cells Dmitry A. Aleksandrov 1 , Anna...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo khoa học: "Anti-obesity activity of diglyceride containing conjugated linoleic acid in C57BL/6J ob/ob mice" potx
... expression. Materials and Methods Experimental materials Experimental materials including DG, CLA, and DG- CLA were obtained from the Illshinwells (Korea). CLA typically produced for experimental purposes ... cholesterol levels, and DG, CLA, and DG-CLA decreased serum TG levels. These results show that CLA and/or DG can regulate lipogenesis and lipolysis to maintain lipid levels in...
Ngày tải lên: 07/08/2014, 23:22