báo cáo khoa học: " Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana" docx

báo cáo khoa học: " Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana" docx

báo cáo khoa học: " Mutations in a plastid-localized elongation factor G alter early stages of plastid development in Arabidopsis thaliana" docx

... CA). Gene specific primers with flanking attB sites were used to amplify the gene (5'GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAACAA TGGCGGCGGATGCTCTGAG3' and 5'GGGGACCACTTT- GTACAAGAAAGCTGGGTCAGCAGCAACTTCTTCTTGAT CCTTG3'). ... inserts (5'AAAAACAAAAGCAGACATCGAC3' for sco1-2, 5'GACCAAACAAAATCACAATAAG3' for sco1-3, and 5'ATGAAACACGAGCTATATTGAG3' for sco1-4...

Ngày tải lên: 12/08/2014, 05:20

10 464 0
báo cáo khoa học: "Helping hands: A cluster randomised trial to evaluate the effectiveness of two different strategies for promoting hand hygiene in hospital nurses" ppsx

báo cáo khoa học: "Helping hands: A cluster randomised trial to evaluate the effectiveness of two different strategies for promoting hand hygiene in hospital nurses" ppsx

... number of coaching sessions, total time spent on coaching, topics dealt with, managers evaluations of coaching. - Coaching of informal leaders - number of coaching sessions, total time spent on coaching, ... handwashing and hand antisepsis in healthcare settings. Am J Infect Control 1995, 23:251-269. 9. Lautenbach E: Practices to Improve Handwashing Compliance. In Making healthcar...

Ngày tải lên: 10/08/2014, 11:20

9 522 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

... observed around the galacturonic acid band. Fig. 2. Glycosylation (A) and chitin-binding (B) characterizations of N63 by SDS ⁄ PAGE. (A) 12% SDS ⁄ PAGE of ASM and deglycosylat- ed-ASM (Deg-ASM) stained ... multifunctional protein that plays a key role in binding chitin, and thus in participating in the structuring of the organic framework, at the same time as finely interacting w...

Ngày tải lên: 22/03/2014, 16:20

14 383 0
Báo cáo khoa học nông nghiệp " Reducing pesticide residues, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " docx

Báo cáo khoa học nông nghiệp " Reducing pesticide residues, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " docx

... vegetables consumed in Vietnam are KangKong, Brassica’s (cabbage, pak choi & kohlrabi) and cucurbits. Nghe An province is located in the central part of Vietnam and there are many vegetables ... Preserving by end-user 1 Cabbage Keep in a cool and moisture place Yes classifying of integrity, size, and preliminary processing, packaging Within 24 hours Keep 1-2 extra...

Ngày tải lên: 21/06/2014, 04:20

13 588 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " First Six-Monthly Report docx

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " First Six-Monthly Report docx

... investigating temperature management and packaging along the supply chain, intensive training of Vietnamese horticulturalists in Australia and the delivery of a large workshop at the end of the ... sustainable production practices. This will involve providing high yielding, disease resistant varieties of watermelon and cabbage, providing information and training in Good Agri...

Ngày tải lên: 21/06/2014, 04:20

10 508 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS6 pdf

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS6 pdf

... research investigating temperature management and packaging along the supply chain, intensive training of Vietnamese horticulturalists in Australia and the delivery of a large workshop at the ... of demonstration variety and GAP trials which are the basis of farmer field days, postharvest research investigating temperature management and packaging along the supply chain and ma...

Ngày tải lên: 21/06/2014, 04:20

8 479 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS7 ppt

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS7 ppt

... Horticultural Research 352, Biomedical Building, 1 Central Avenue, Australian Technology Park, Eveleigh N.S.W. 2015 Australia Email: gordon@ahr.com.au In Australia: Administrative contact Name: ... Team Leader Dr Chuong Australian Organisation Applied Horticultural Research Pty. Ltd.(AHR) ACN 073 642 510; Suite 352 Biomedical Building 1 Central Ave, Everleigh NSW 2015 Austra...

Ngày tải lên: 21/06/2014, 04:20

4 468 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS8 doc

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS8 doc

... establishment of demonstration variety and GAP trials which will be the basis of farmer field days, postharvest research investigating temperature management and packaging along the supply chain, ... (v) Deliver training on agronomy, supply and marketing of cabbage in preparation for the coming winter crop in the form of Farmer Field Schools. A report on training activities...

Ngày tải lên: 21/06/2014, 04:20

8 381 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS10 pdf

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS10 pdf

... Kimpton (AHR) in consultation with ASINCV staff and PPD staff in Vietnam. Training was delivered (see training summary) and a detailed program is attached to this milestone report. An IPM program ... for cabbage was developed early in the project, through a study tour of ASINCV staff to Australia and consultation with PPD staff in Vietnam. The cabbage IPM program is outlin...

Ngày tải lên: 21/06/2014, 04:20

11 390 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS12 ppt

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS12 ppt

... and GAP trials which will be the basis of farmer field days, postharvest research investigating temperature management and packaging along the supply chain, intensive training of Vietnamese ... watermelon and cabbage, providing information and training in Good Agricultural Practice. The introduction of new varieties and GAP will be implanted using a participatory approach with f...

Ngày tải lên: 21/06/2014, 04:20

30 373 0
Từ khóa:
w