báo cáo khoa học: " ESTs from a wild Arachis species for gene discovery and marker development" pdf

báo cáo khoa học: " ESTs from a wild Arachis species for gene discovery and marker development" pdf

báo cáo khoa học: " ESTs from a wild Arachis species for gene discovery and marker development" pdf

... number not for citation purposes) BMC Plant Biology Open Access Research article ESTs from a wild Arachis species for gene discovery and marker development Karina Proite 1,2 , Soraya CM Leal-Bertioli 2 , ... leaf spot [15] and unstressed tissues [16]. However, at present a total of roughly 25,000 Arachis ESTs are available in Genbank, all derived from cultiv...

Ngày tải lên: 12/08/2014, 05:20

10 339 0
báo cáo khoa học: " The first set of EST resource for gene discovery and marker development in pigeonpea (Cajanus cajan L.)" ppsx

báo cáo khoa học: " The first set of EST resource for gene discovery and marker development in pigeonpea (Cajanus cajan L.)" ppsx

... Saxena RK, Datta S, Sharma TR, Rosen B, Carrasquilla-Garcia N, Farmer AD, Dubey A, Saxena KB, Gao J, Fakrudin B, Singh MN, Singh BP, Wanjari KB, Yuan M, Srivastava RK, Kilian A, Upadhyaya HD, Mallikarjuna ... Belaghihalli N Gnanesh 1,2 , Pazhamala Lekha 1 , Balaji Jayashree 1 , Suresh Pande 1 , Pavana J Hiremath 1 , Munishamappa Byregowda 2 , Nagendra K Singh 3 , Rajeev K Varshney 1,4* Abst...

Ngày tải lên: 12/08/2014, 03:21

22 365 0
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot

... teams have two data analysts and one manager, and the other six teams have one data ana- lyst and one manager). Initially, twelve OEYC data ana- lyst/manager dyads were asked to participate and ... Ontario, Canada and 6 Department of Geography, University of Ottawa, K1N 6N5, Ottawa, Ontario, Canada Email: Anita Kothari* - akothari@uwo.ca; S Michelle Driedger - driedge3@cc.umanitoba...

Ngày tải lên: 11/08/2014, 05:22

9 339 0
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps

... data analysts and eight managers participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data ana- lyst and one manager). ... needs. As a result some data analysts are less trained than others to engage in mapping: &apos ;And again, the other thing, the DACs [data analysts] were hired and there wasn&a...

Ngày tải lên: 11/08/2014, 16:20

9 318 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary March edition. London; 2003. 17. National Coordinating Council for Medication Error: Taxonomy ... analysis, interpretation and drafting the manuscript. Acknowledgements To the Medical Statistics Unit, Research and Development Directorate, UCL Hospitals and to Steve Batson for pr...

Ngày tải lên: 25/10/2012, 10:39

6 526 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Free ligands were adsorbed on charcoal, and the absorbance spectra were recorded. Concentration of appearing IF–CNCbl was calculated by comparison with the standards IF–H 2 OCbl and IF–CNCbl according ... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from human placenta. J Biol Chem 253, 1766–1772. 22 Quadros EV, Nakayama Y & Seq...

Ngày tải lên: 19/02/2014, 05:20

12 603 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a colon and ... cerevisiae DNA was used as a PCR template for PCR. For construction of pUG35-LPX1 (LPX1–GFP), PCR-amplified YOR084w (primers 5¢-GCTCTAGAATG GAACAGAACAGGTTCAAG-3¢ and 5¢-C...

Ngày tải lên: 07/03/2014, 05:20

11 569 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: Emergence of a subfamily of xylanase inhibitors within glycoside hydrolase family 18 pdf

Báo cáo khoa học: Emergence of a subfamily of xylanase inhibitors within glycoside hydrolase family 18 pdf

... 10 min for A. niger xylanase or for 5 min for XYNC and T. longibrachiatum M3 xylanases. The E : I 50 was calculated with the sigma plot program. The chitinase activity assay was performed at two ... rice (Oryza sativa L.). Enzyme Microbial Technol 30, 697–702. 13 Nagasaki H, Yamamoto K, Shomura A, Koga-Ban Y, Takasuga A, Yano M, Minobe Y & Sasaki T (1997) Rice class III chitina...

Ngày tải lên: 07/03/2014, 17:20

11 442 0
Báo cáo khoa học: tmRNA from Thermus thermophilus Interaction with alanyl-tRNA synthetase and elongation factor Tu pptx

Báo cáo khoa học: tmRNA from Thermus thermophilus Interaction with alanyl-tRNA synthetase and elongation factor Tu pptx

... for Ala$tmRNA and Ala$tRNA Ala pro- tection against alkaline hydrolysis at 40 °CbyTh. aquaticus EF-Tu in complex with GDPNP. Constants Ala$tmRNA Ala$tRNA Ala Value Standard error Value Standard error k 1 , ... and alanyl- ated RNA, respectively. At the given conditions, both Ala$tmRNA and Ala$tRNA Ala associate with alanyl- tRNA synthetase much slower, than uncharged tmRNA and tRNA...

Ngày tải lên: 08/03/2014, 08:20

13 380 0
w