báo cáo khoa học: " An ABRE-binding factor, OSBZ8, is highly expressed in salt tolerant cultivars than in salt sensitive cultivars of indica rice" doc

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the specifici...

Ngày tải lên: 14/02/2014, 14:20

... Journal compilation ê 2009 FEBS 127 An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy ... of distinct substrates. Results and Discussion We screened a collection of LF mutants, which were generated by error-prone PCR, for a mutant that was defective at...

Ngày tải lên: 16/02/2014, 09:20

... 6A,B). The protein content in the 8K-BLP-treated disks increased significantly, and was A E B C D Fig. 3. Determination of the structure of 8K-BLP. (A) MALDI-TOF MS analysis of the purified peptide. ... Members of the insulin-like peptide (ILP) family are present in a wide variety of metazoans. In vertebrates, insulin and insulin-like growth factors (IGFs) regulate...

Ngày tải lên: 18/02/2014, 13:20

... Gharibyan AL, Zamotin V, Yanamandra K, Moskaleva OS, Margulis BA, Kostanyan IA & Morozova-Roche LA (2007) Lysozyme amyloid oligomers and fibrils induce cellular death via different apoptotic ... An orphan dermaseptin from frog skin reversibly assembles to amyloid-like aggregates in a pH-dependent fashion Ruth Go ă òler-Scho ă fberger 1 ,Gu ă nter Hesser 2 , Ma...

Ngày tải lên: 23/03/2014, 04:20

... Authors Journal compilation ê 2006 FEBS Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast Mourad Barhoumi 1 , N. K. Tanner 2 , ... Trypanosoma sp. gen- ome projects (http://www.genedb.org/). Translation initiation in mammals and yeast is well studied; it involves many RN...

Ngày tải lên: 23/03/2014, 10:20

... Journal compilation ª 2009 FEBS Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein Makiko Kawaguchi, Hiroshi Orikawa, Takashi Baba, ... report that hepatocyte growth factor activator (HGFA), a serum proteinase which activates hepatocyte growth factor in response to tissue injury, may hav...

Ngày tải lên: 29/03/2014, 23:20

... enhancer factor 2B is involved in the inducible expression of NOX1 ⁄ NADPH oxidase, a vascular superoxide-producing enzyme Masato Katsuyama*, Muhammer Ozgur Cevik*, Noriaki Arakawa, Tomoko Kakehi, ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy- agishi M, Taira K & Yabe-Nishimura C (2005) Essen- tial role of ATF-1 in induction of NOX1, a catalyt...

Ngày tải lên: 30/03/2014, 03:20

... and showed low pathogenic characteristics in the vaccine strain (01310 CE20), the pathogenicity in ECEs was increased. Therefore, we tested the pathogenicity of the vaccine strain in SPF chickens. ... permitted the use of the vaccine for LPAI (especially the H9N2 subtype), and the Committee on the National AI Vaccine Campaign determined that using a s...

Ngày tải lên: 07/08/2014, 20:23

... Coast, Djibouti, Equatorial Guinea, Eritrea, Ethiopia, Gabon, Gambia, Ghana, Guinea, Guinea-Bissau, Kenya, Lesotho, Liberia, Madagascar, Malawi, Mali, Mauritania, Mauritius, Mozambique, Namibia, ... have rates under 2%, whereas Ghana, Sudan and Table 1: Geographical and risk factor related key words Region/Country Specific Africa, sub-Saharan Africa, additionally each country in su...

Ngày tải lên: 11/08/2014, 14:21

... MPI structure in the Spanish sample of temporomandibular patients are the elimination and change of some items in section I, and the combination of two of the original scales in a sin- gle one in ... of the psychometric structure of the Multidimensional Pain Inventory in temporomandibular disorder patients: a confirmatory factor an...

Ngày tải lên: 11/08/2014, 23:22

... ascertain if there is an identifiable protein motif specific for anthocyanin- promoting MYBs in the N-term- inal R2R3 domain, the isolated rosaceous MYBs and other anthocyanin- promoting MYBs (16 ... as: Lin-Wang et al.: An R2R3 MYB transcription factor associated with regulation of the anthocyanin biosynthetic pathway in Rosaceae. BMC Plant Biology 201...

Ngày tải lên: 12/08/2014, 03:21

... to determine the prevalence of HEV infection in pregnant women in Ghana, and demonstrates the high prevalence of and the considerable potential for the transmission of HEV infection in pregnant women ... t-test. We also obtained the frequency of seropositive and seron- egative women. In the bivariate analysis, we evaluated the relationship between the age and serum result...

Ngày tải lên: 12/08/2014, 04:22

... citation purposes) BMC Plant Biology Open Access Research article An ABRE-binding factor, OSBZ8, is highly expressed in salt tolerant cultivars than in salt sensitive cultivars of indica rice Kakali ... difference in the level of ABRE-binding- factor in lamina of salt sensitive and salt tolerant rice cultivars. It is believed that high l...

Ngày tải lên: 12/08/2014, 05:20

... coagulopathic patients from two randomized, placebo-controlled, double-blind trials of rFVIIa as an adjunctive therapy for bleeding in patients with severe trauma. Methods Blunt and penetrating trauma patients ... S, Rossaint R, Axelsen M, Kluger Y, NovoSeven Trauma Study Group: Recom- binant factor VIIa as adjunctive therapy for bleeding contro...

Ngày tải lên: 13/08/2014, 03:20