Báo cáo khoa học: "Diversification of West Nile virus in a subtropical region" potx

... 2 nd (5514–6318) 5'-TTCCACAAAGGTCGAGCTAGG-3' (5514–5534) 5'-CCTAGGACCATCAAAGCACCA-3' (6298–6318) NS3 3 rd (5950–6726) 5'-CCATCTGCAGTGACAGCAGCTA-3' (5950–5971) 5'-TTCGTTCCTGGAACTTCAGCC-3' (6756–6776) Primer ... Taken together, these findings expand our understanding of the temporal and spatial compartmentalization of West Nile virus subtypes wi...

Ngày tải lên: 12/08/2014, 04:22

... 2 nd (1632–2459) 5'-CCTTGGAGCAGTGCTGGAAGTA-3' (1636–1657) 5'-TTCACGGAGAGGAAGAGCAGAA-3' (2438–2459) NS3 1 st (5085–5908) 5'-CGGCTCATACATAAGCGCGAT-3' (5085–5105) 5'-TTGGTTTCACACTCTTCCGGC-3' (5888–5908) NS3 ... findings expand our understanding of the temporal and spatial compartmentalization of West Nile virus subtypes within North America. It w...

Ngày tải lên: 12/08/2014, 04:21

... he was afebrile (temperature of 36.5°C) and hemodynamically stable. Neurological examination revealed flaccid paralysis of the right leg and absent patellar and ankle reflexes. The remainder of ... of the cauda equina and nerve roots of the lumbosacral spine. Serum IgM was positive for West Nile virus and EMG was consistent with multiple root inflammation of the cauda equina...

Ngày tải lên: 10/08/2014, 23:20

... extension: tailor-made genes using the polymerase chain reaction. Biotechniques 8, 528–535. 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M ... psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses Muhammad S. Rohman 1 , Takashi Tadokoro 1 , Clement Angkawidjaja 1 , Yumi Abe...

Ngày tải lên: 18/02/2014, 13:20

... cloning of PA0266 were as follows: 5’-GGAATTCCATATGAGCAAGACCAACG AATCCC-3’ and 5’-CCGCTCGAGAGCGAGTTCGTCG AAGCACTCGG-3’. PCR was performed using KOD-plus DNA polymerase (Toyobo Co., Ltd, Osaka, Japan) ... pathway in P. aeruginosa using EC number information. As a result, we identified PA0266 as a putative 5-aminovalerate aminotransferase (EC 2.6.1.48) and PA0265 as a putative glutarat...

Ngày tải lên: 07/03/2014, 09:20

... 5¢-GCCCTCGAGAAAAGATC TAGAACTGGAGCTTACGGAG-3¢ for C 4A, 5¢-CAAA AGCTTTCTGTCGATCCAGC-3¢ for C60S, 5¢-CAAAAG CTTGCTGTCGATCCAGC-3¢ for C6 0A, 5¢-TCTTCTAA GTCTGCTAAGCCAGAAAAGCTGAACTACTCT GGA GTTG-3¢ ... lysozyme Shunsuke Kawamura 1 , Mari Ohkuma 1 , Yuki Chijiiwa 1 , Daiki Kohno 1 , Hiroyuki Nakagawa 1 , Hideki Hirakawa 2 , Satoru Kuhara 2,3 and Takao Torikata 1 1 Department of Bioscience, Schoo...

Ngày tải lên: 16/03/2014, 06:20

... (downstream) 5’-TCAGACCCTGAGGCTCAAAGTC-3’ CML 3 (upstream) 5’-CGCATGTTCCGGGACAAAAGC-3’ Wang et al. Journal of Hematology & Oncology 2010, 3:14 http://www.jhoonline.org/content/3/1/14 Page 3 of ... human melanomas. J Immunol 1994, 153:2807-2818. 25. Fayad L, Kantarjian H, O’Brien S, Seong D, Albitar M, Keating M, Talpaz M: Emergence of new clonal abnormalities following interferon-al...

Ngày tải lên: 10/08/2014, 22:21

... gtgagatggcatcggagatgagca ctggctgccacccctatttgcatt 1,495 OsCALS8R Os01g55040 cactcggcgtggaggaattacgac aacactgcgaatctcccccagatg 999 OsDREB Os01g07120 catcgtggcgcaacatgaaaaaga ccacagtgcactcaacacacagtacaa ... ccacagtgcactcaacacacagtacaa 1,167 OsEXTE Os10g33970 tgtttgccttccgttaatgccaca agcgcccctaatccgaaccaaag 1,433 OsMAPK Os07g38530 gccggaagcgttgtacaaggtcaa cggcaagaaagcatttcaggcatc 1,495 OsPITA Os...

Ngày tải lên: 12/08/2014, 05:20

... epidemio- logical confirmation and circumstances of occur- rence of sheep (S) strains of Mycobacterium avium subsp. paratuberculosis in cases of paratu- berculosis in cattle in Australia and sheep and cat- tle ... and serological, pathological, and bacteriological examination. Material and Methods Farm management The farm was located in Hordaland-county in Western Norway. Du...

Ngày tải lên: 12/08/2014, 15:21

... serves as chair of the Advanced Bleeding Care (ABC) European medical education initiative and as co- chair of the ABC-Trauma (ABC-T) European medical educa- tion initiative, both of which are managed ... be maintained following injury. An argument can be made for maintaining a higher level of platelets, perhaps up to 100 × 10 9 /l, following injury. If a patient has increased fibr...

Ngày tải lên: 13/08/2014, 03:20