Báo cáo khoa học: "Detection and phylogenetic analysis of Orf virus from sheep in Brazil: a case report" pptx

... MI, da Fonseca FG, dos Santos JR, Bonjardim CA, Ferreira PC, Kroon EG: Short report: Isolation of two vaccinia virus strains from a single bovine vaccinia outbreak in rural area from Brazil: ... Brazilian samples were grouped with Asiatic isolates, ORFV-India82/04 and ORFV-Taiping, respectively. Although the phylogenetic analysis can indicate a hypothetical origin of v...

Ngày tải lên: 12/08/2014, 04:21

... disease. Between 1980s and 1990s, orf occurred in eight provinces of China including Qinghai, Gansu, Tibet, Xinjiang, Liaoning, Jiangxi, Heilongjiang and Hebei. In recent years orf hap- pened in ... women and four men were infected by ORFV in Fujian province. So, orf is a national zoonoses in China. In this study, we diagnosed an outbreak of orf in Chinese go...

Ngày tải lên: 12/08/2014, 04:20

... J, Haas BJ, Wortman JR, Hine EE, Althoff R, Arbogast TS, Tallon LJ, et al.: Comparative genomics of Brassica oleracea and Arabidopsis thaliana reveal gene loss, fragmentation, and dispersal after ... 2 Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada Email: Bo Yang - byang@ualberta.ca; Yuanqing Jiang - yuanqing@ualberta.ca; Muhammad H Rah...

Ngày tải lên: 12/08/2014, 03:20

... possible sources of gas within the intestine are considered nowa- days: intra-luminal gas, gas produced by bacteria and pulmonary gas. For the latter, the possibility of gas com- ing from the lungs as a source ... mechanical and bacterial causes [2]. Whatever the pathogenesis, gas forming bacteria gain access to the submucosa through breaches in the mucosa and, once inside the...

Ngày tải lên: 10/08/2014, 22:24

... Yemen Email: Abdulzahra Hussain* - azahrahussain@yahoo.com; Hind Mahmood - hindkass@yahoo.com; Hussein Almusawy - halmusawy@yhaoo.co.uk * Corresponding author Abstract Introduction: Infantile haemangioma ... citation purposes) Journal of Medical Case Reports Open Access Case report Moderate size infantile haemangioma of the neck – conservative or surgical treatment? : a case r...

Ngày tải lên: 11/08/2014, 11:20

... Linguistics Subjectivity and Sentiment Analysis of Modern Standard Arabic Muhammad Abdul-Mageed Department of Linguistics & School of Library & Info. Science, Indiana University, Bloomington, USA, mabdulma@indiana.edu Mona ... knowledge, no SSA annotated MSA data ex- ists. Hence we decided to create our own SSA an- notated data. 1 2.1 Data set and Annotation Corpus: Two co...

Ngày tải lên: 20/02/2014, 05:20

... cytoplasmic 1 c-Actin Actin, cytoplasmic 1 Tubulin b Tubulin a Ankyrin repeat domain-containing protein 1 8A Ankyrin repeat domain-containing protein 1 8A Heat-shock protein b1 a- Actin-2 Unclassified Keratin, ... min at 13 000 g, and an aliquot of the superna- tant (1.5 mg of protein) was incubated with 2 lg of anti- body against VASP, antibody against B23 and antibody against...

Ngày tải lên: 06/03/2014, 22:21

... Asp140, whichappearstobecrucialinChiBandinchitinaseA1 from Bacillus circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases [28,30]. Preliminary results of ... mutated in this study are shown in Fig. 2. Asp140, Asp142, Glu144 and Asp215 were mutated indi- vidually to asparagine and alanine, Tyr10 and Tyr214 were replaced by P...

Ngày tải lên: 07/03/2014, 14:20

... TATTTACAAATTTACCTATACGCTCTGAGTTGATATTAC ATCGATGAATTCGAGCTCG KU1130 GCTAATAACAACTAATATCACTAACAGAAGACCATTAC CCCGTACGCTGCAGGTCGAC KU1131 GGAGGATTTATCAAAAGCTACTTCGAAAGCTAGGAACG AACGTACGCTGCAGGTCGAC KU1132 ... CCTTCTTTGATTGTGCTGCAGAACGTTGAGGCTCTATT TGG KU532 CCAAATAGAGCCTCAACGTTCTGCAGCACAATCAAAGA AGG KU616 CGGATCCATGGTTAAAGATATTATCGAAAGGCATTTGC KU617 CCGCATGCGGCCGCTCAAGATGGTGTAAACGCACTAA GCG KU718...

Ngày tải lên: 07/03/2014, 16:20

... 5¢-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse). The pET151 HP1287 plasmid was ... present any activity on thiamin degradation. Other enzymes involved in the thiamin pathway A comparative analysis of the thiamin biosynthetic pathway of more than 80 bacterial gen...

Ngày tải lên: 16/03/2014, 00:20